Incidental Mutation 'R0573:Myoc'
ID46504
Institutional Source Beutler Lab
Gene Symbol Myoc
Ensembl Gene ENSMUSG00000026697
Gene Namemyocilin
SynonymsTIGR, GLC1A
MMRRC Submission 038763-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0573 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162639155-162649693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 162648674 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 316 (Y316H)
Ref Sequence ENSEMBL: ENSMUSP00000028020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028020] [ENSMUST00000169439] [ENSMUST00000193898]
Predicted Effect probably damaging
Transcript: ENSMUST00000028020
AA Change: Y316H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028020
Gene: ENSMUSG00000026697
AA Change: Y316H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
coiled coil region 96 169 N/A INTRINSIC
OLF 232 489 2.54e-161 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169439
SMART Domains Protein: ENSMUSP00000127102
Gene: ENSMUSG00000091060

DomainStartEndE-ValueType
low complexity region 101 113 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193257
Predicted Effect probably benign
Transcript: ENSMUST00000193898
SMART Domains Protein: ENSMUSP00000141822
Gene: ENSMUSG00000091060

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
Meta Mutation Damage Score 0.6647 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible response protein (TIGR). The trabecular meshwork is a specialized eye tissue essential in regulating intraocular pressure, and mutations in MYOC have been identified as the cause of hereditary juvenile-onset open-angle glaucoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile and display no ocular abnormalities at the light and ultrastructural microscopic levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,491,658 K698N possibly damaging Het
Adcy8 A T 15: 64,822,195 V411D probably damaging Het
Arfgef3 T A 10: 18,599,288 E1550V probably damaging Het
Asb3 T A 11: 31,061,406 I306K probably damaging Het
Asic4 T A 1: 75,469,102 probably benign Het
B020004J07Rik A C 4: 101,835,414 V463G probably damaging Het
Basp1 G T 15: 25,364,862 D16E unknown Het
Cbll1 A T 12: 31,490,540 I123N probably damaging Het
Ccdc141 A T 2: 77,039,493 H889Q probably benign Het
Ccdc65 T C 15: 98,721,049 V303A probably benign Het
Ceacam20 T A 7: 19,986,668 M60K probably damaging Het
Chd9 T A 8: 90,998,595 V711D probably damaging Het
Clcn1 T A 6: 42,313,045 probably null Het
Col16a1 A T 4: 130,068,475 probably benign Het
Col4a3 C A 1: 82,716,363 P1568Q possibly damaging Het
Colec12 C A 18: 9,858,650 P478T probably damaging Het
Dchs1 T C 7: 105,758,778 H1949R probably damaging Het
Dgka A G 10: 128,737,007 probably null Het
Dlgap4 A G 2: 156,746,191 I669V probably benign Het
Dsg1c T A 18: 20,279,241 D543E probably benign Het
Egflam A T 15: 7,242,425 C677* probably null Het
Eml5 A C 12: 98,824,772 probably null Het
Fbn1 G A 2: 125,389,249 R466C probably damaging Het
Fnbp1 C A 2: 31,058,978 D198Y probably damaging Het
Gfra3 T A 18: 34,691,615 M272L probably benign Het
Gm5422 T A 10: 31,250,160 noncoding transcript Het
Gpr21 T A 2: 37,517,544 I34N probably damaging Het
Hspb2 G T 9: 50,751,364 T155K probably benign Het
Il21r A G 7: 125,625,285 T24A probably benign Het
Mmadhc T A 2: 50,292,835 H43L possibly damaging Het
Morn1 T A 4: 155,111,016 D278E possibly damaging Het
Nags A G 11: 102,146,979 D266G probably damaging Het
Nlrp4b A G 7: 10,714,215 N115S probably benign Het
Nlrp5 T A 7: 23,417,631 I260N probably damaging Het
Obscn G A 11: 59,036,079 R6190C probably damaging Het
Olfr1105 A G 2: 87,033,468 F251S probably damaging Het
Olfr1449 T C 19: 12,935,260 V174A possibly damaging Het
Orc4 C T 2: 48,917,273 M215I probably benign Het
Osbpl6 A T 2: 76,590,391 H770L probably damaging Het
Otogl A C 10: 107,780,988 N1809K probably benign Het
Pde3a G T 6: 141,492,231 V1009L probably damaging Het
Pign T C 1: 105,653,177 Y159C probably damaging Het
Pik3cg C A 12: 32,197,197 M842I probably damaging Het
Pnliprp1 C T 19: 58,734,882 T235I possibly damaging Het
Prpf8 A G 11: 75,490,654 N239D probably damaging Het
Psd2 T A 18: 35,980,493 probably benign Het
Ptprt T C 2: 161,551,748 D1251G probably damaging Het
Pwp2 G A 10: 78,182,686 S88L probably benign Het
Rassf4 C T 6: 116,647,555 probably benign Het
Rexo1 A G 10: 80,544,850 S884P probably damaging Het
Rgs20 C A 1: 5,020,814 R131L possibly damaging Het
Setd4 A G 16: 93,589,946 V288A probably benign Het
Stx3 G T 19: 11,785,746 T160K probably damaging Het
Tas2r102 T A 6: 132,762,673 S181R probably damaging Het
Tenm3 T C 8: 48,674,399 probably benign Het
Tmem33 T C 5: 67,264,260 probably benign Het
Trim33 A G 3: 103,351,990 probably benign Het
Trip11 A G 12: 101,886,860 I491T probably benign Het
Trp53bp1 A G 2: 121,228,172 probably benign Het
Tuba4a T C 1: 75,216,373 D199G probably benign Het
Zcchc4 A G 5: 52,795,979 Y110C probably damaging Het
Zp2 C T 7: 120,135,470 probably benign Het
Other mutations in Myoc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Myoc APN 1 162639774 missense probably benign 0.10
IGL02314:Myoc APN 1 162639348 missense probably damaging 1.00
IGL02707:Myoc APN 1 162639460 missense probably benign 0.28
R0033:Myoc UTSW 1 162648441 missense probably damaging 1.00
R0193:Myoc UTSW 1 162649035 missense probably damaging 1.00
R1433:Myoc UTSW 1 162648996 missense probably damaging 1.00
R1525:Myoc UTSW 1 162648651 missense probably damaging 1.00
R1637:Myoc UTSW 1 162639367 missense probably damaging 1.00
R2268:Myoc UTSW 1 162649056 missense probably damaging 1.00
R2883:Myoc UTSW 1 162639616 missense possibly damaging 0.76
R4437:Myoc UTSW 1 162649112 missense possibly damaging 0.67
R4845:Myoc UTSW 1 162647465 missense possibly damaging 0.95
R4904:Myoc UTSW 1 162639425 missense probably benign 0.25
R5092:Myoc UTSW 1 162639634 missense probably damaging 1.00
R5629:Myoc UTSW 1 162648587 missense probably damaging 1.00
R5847:Myoc UTSW 1 162639367 missense probably damaging 1.00
R5920:Myoc UTSW 1 162639559 missense probably benign
R6326:Myoc UTSW 1 162649011 missense probably damaging 1.00
R6589:Myoc UTSW 1 162648619 nonsense probably null
R6932:Myoc UTSW 1 162639346 missense probably damaging 1.00
R7282:Myoc UTSW 1 162648844 missense probably benign 0.04
R7697:Myoc UTSW 1 162647480 missense probably damaging 1.00
R7698:Myoc UTSW 1 162639445 missense probably damaging 1.00
R7724:Myoc UTSW 1 162639827 critical splice donor site probably null
R7791:Myoc UTSW 1 162649121 missense probably damaging 1.00
Z1176:Myoc UTSW 1 162639636 nonsense probably null
Z1176:Myoc UTSW 1 162649154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAAACAATCGCTGGCAAGTATG -3'
(R):5'- TACGCTCAAGTTCCAGGTTCGC -3'

Sequencing Primer
(F):5'- AGTGTGGATGAGAGACCCC -3'
(R):5'- CGTGCTGTAGATGACCCAGAG -3'
Posted On2013-06-11