Incidental Mutation 'R0573:Mmadhc'
ID46508
Institutional Source Beutler Lab
Gene Symbol Mmadhc
Ensembl Gene ENSMUSG00000026766
Gene Namemethylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Synonyms2010311D03Rik
MMRRC Submission 038763-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R0573 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location50279881-50296801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50292835 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 43 (H43L)
Ref Sequence ENSEMBL: ENSMUSP00000115961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102769] [ENSMUST00000133768] [ENSMUST00000144143]
Predicted Effect probably benign
Transcript: ENSMUST00000102769
AA Change: H43L

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099830
Gene: ENSMUSG00000026766
AA Change: H43L

DomainStartEndE-ValueType
Pfam:DUF2246 24 294 8.5e-134 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123699
Predicted Effect possibly damaging
Transcript: ENSMUST00000133768
AA Change: H43L

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115961
Gene: ENSMUSG00000026766
AA Change: H43L

DomainStartEndE-ValueType
Pfam:DUF2246 20 179 1.8e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140563
Predicted Effect possibly damaging
Transcript: ENSMUST00000144143
AA Change: H43L

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122804
Gene: ENSMUSG00000026766
AA Change: H43L

DomainStartEndE-ValueType
Pfam:DUF2246 20 219 1.5e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228816
Meta Mutation Damage Score 0.1949 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that is involved in an early step of vitamin B12 metabolism. Vitamin B12 (cobalamin) is essential for normal development and survival in humans. Mutations in this gene cause methylmalonic aciduria and homocystinuria type cblD (MMADHC), a disorder of cobalamin metabolism that is characterized by decreased levels of the coenzymes adenosylcobalamin and methylcobalamin. Pseudogenes have been identified on chromosomes 11 and X.[provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,491,658 K698N possibly damaging Het
Adcy8 A T 15: 64,822,195 V411D probably damaging Het
Arfgef3 T A 10: 18,599,288 E1550V probably damaging Het
Asb3 T A 11: 31,061,406 I306K probably damaging Het
Asic4 T A 1: 75,469,102 probably benign Het
B020004J07Rik A C 4: 101,835,414 V463G probably damaging Het
Basp1 G T 15: 25,364,862 D16E unknown Het
Cbll1 A T 12: 31,490,540 I123N probably damaging Het
Ccdc141 A T 2: 77,039,493 H889Q probably benign Het
Ccdc65 T C 15: 98,721,049 V303A probably benign Het
Ceacam20 T A 7: 19,986,668 M60K probably damaging Het
Chd9 T A 8: 90,998,595 V711D probably damaging Het
Clcn1 T A 6: 42,313,045 probably null Het
Col16a1 A T 4: 130,068,475 probably benign Het
Col4a3 C A 1: 82,716,363 P1568Q possibly damaging Het
Colec12 C A 18: 9,858,650 P478T probably damaging Het
Dchs1 T C 7: 105,758,778 H1949R probably damaging Het
Dgka A G 10: 128,737,007 probably null Het
Dlgap4 A G 2: 156,746,191 I669V probably benign Het
Dsg1c T A 18: 20,279,241 D543E probably benign Het
Egflam A T 15: 7,242,425 C677* probably null Het
Eml5 A C 12: 98,824,772 probably null Het
Fbn1 G A 2: 125,389,249 R466C probably damaging Het
Fnbp1 C A 2: 31,058,978 D198Y probably damaging Het
Gfra3 T A 18: 34,691,615 M272L probably benign Het
Gm5422 T A 10: 31,250,160 noncoding transcript Het
Gpr21 T A 2: 37,517,544 I34N probably damaging Het
Hspb2 G T 9: 50,751,364 T155K probably benign Het
Il21r A G 7: 125,625,285 T24A probably benign Het
Morn1 T A 4: 155,111,016 D278E possibly damaging Het
Myoc T C 1: 162,648,674 Y316H probably damaging Het
Nags A G 11: 102,146,979 D266G probably damaging Het
Nlrp4b A G 7: 10,714,215 N115S probably benign Het
Nlrp5 T A 7: 23,417,631 I260N probably damaging Het
Obscn G A 11: 59,036,079 R6190C probably damaging Het
Olfr1105 A G 2: 87,033,468 F251S probably damaging Het
Olfr1449 T C 19: 12,935,260 V174A possibly damaging Het
Orc4 C T 2: 48,917,273 M215I probably benign Het
Osbpl6 A T 2: 76,590,391 H770L probably damaging Het
Otogl A C 10: 107,780,988 N1809K probably benign Het
Pde3a G T 6: 141,492,231 V1009L probably damaging Het
Pign T C 1: 105,653,177 Y159C probably damaging Het
Pik3cg C A 12: 32,197,197 M842I probably damaging Het
Pnliprp1 C T 19: 58,734,882 T235I possibly damaging Het
Prpf8 A G 11: 75,490,654 N239D probably damaging Het
Psd2 T A 18: 35,980,493 probably benign Het
Ptprt T C 2: 161,551,748 D1251G probably damaging Het
Pwp2 G A 10: 78,182,686 S88L probably benign Het
Rassf4 C T 6: 116,647,555 probably benign Het
Rexo1 A G 10: 80,544,850 S884P probably damaging Het
Rgs20 C A 1: 5,020,814 R131L possibly damaging Het
Setd4 A G 16: 93,589,946 V288A probably benign Het
Stx3 G T 19: 11,785,746 T160K probably damaging Het
Tas2r102 T A 6: 132,762,673 S181R probably damaging Het
Tenm3 T C 8: 48,674,399 probably benign Het
Tmem33 T C 5: 67,264,260 probably benign Het
Trim33 A G 3: 103,351,990 probably benign Het
Trip11 A G 12: 101,886,860 I491T probably benign Het
Trp53bp1 A G 2: 121,228,172 probably benign Het
Tuba4a T C 1: 75,216,373 D199G probably benign Het
Zcchc4 A G 5: 52,795,979 Y110C probably damaging Het
Zp2 C T 7: 120,135,470 probably benign Het
Other mutations in Mmadhc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Mmadhc APN 2 50289031 missense probably benign
IGL01732:Mmadhc APN 2 50281185 missense probably damaging 1.00
IGL02397:Mmadhc APN 2 50288980 missense possibly damaging 0.82
R0091:Mmadhc UTSW 2 50292857 missense probably damaging 1.00
R0458:Mmadhc UTSW 2 50281161 missense probably benign 0.01
R1613:Mmadhc UTSW 2 50280326 missense probably damaging 1.00
R2189:Mmadhc UTSW 2 50288946 missense probably damaging 1.00
R4092:Mmadhc UTSW 2 50287883 missense probably benign
R4214:Mmadhc UTSW 2 50291332 missense probably benign
R4498:Mmadhc UTSW 2 50280224 missense probably benign 0.25
R5355:Mmadhc UTSW 2 50291424 missense probably benign 0.18
R5961:Mmadhc UTSW 2 50291409 missense probably damaging 1.00
R7343:Mmadhc UTSW 2 50291445 missense probably damaging 1.00
X0018:Mmadhc UTSW 2 50287917 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCTGGTTCAGAGACTGTATGTCAGATGA -3'
(R):5'- cccaagcacacacCTGTGCAA -3'

Sequencing Primer
(F):5'- acatttttcttcaggtagcaacag -3'
(R):5'- gcacacacCTGTGCAATCATC -3'
Posted On2013-06-11