Incidental Mutation 'R0573:Osbpl6'
ID46509
Institutional Source Beutler Lab
Gene Symbol Osbpl6
Ensembl Gene ENSMUSG00000042359
Gene Nameoxysterol binding protein-like 6
Synonyms1110062M20Rik, ORP-6
MMRRC Submission 038763-MU
Accession Numbers

Genbank: NM_145525; MGI: 2139014

Is this an essential gene? Possibly essential (E-score: 0.578) question?
Stock #R0573 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location76406508-76600647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76590391 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 770 (H770L)
Ref Sequence ENSEMBL: ENSMUSP00000107560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077972] [ENSMUST00000111929] [ENSMUST00000111930] [ENSMUST00000184442]
Predicted Effect probably damaging
Transcript: ENSMUST00000077972
AA Change: H778L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077123
Gene: ENSMUSG00000042359
AA Change: H778L

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
low complexity region 537 550 N/A INTRINSIC
Pfam:Oxysterol_BP 603 951 1.4e-135 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111929
AA Change: H770L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107560
Gene: ENSMUSG00000042359
AA Change: H770L

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
coiled coil region 441 472 N/A INTRINSIC
low complexity region 529 542 N/A INTRINSIC
Pfam:Oxysterol_BP 595 944 1.1e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111930
AA Change: H739L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107561
Gene: ENSMUSG00000042359
AA Change: H739L

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
coiled coil region 410 441 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:Oxysterol_BP 564 913 1e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184442
AA Change: H632L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139363
Gene: ENSMUSG00000042359
AA Change: H632L

DomainStartEndE-ValueType
Blast:PH 1 70 8e-41 BLAST
low complexity region 87 98 N/A INTRINSIC
coiled coil region 142 172 N/A INTRINSIC
coiled coil region 303 334 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
Pfam:Oxysterol_BP 457 794 2.6e-135 PFAM
Meta Mutation Damage Score 0.5167 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

 

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,491,658 K698N possibly damaging Het
Adcy8 A T 15: 64,822,195 V411D probably damaging Het
Arfgef3 T A 10: 18,599,288 E1550V probably damaging Het
Asb3 T A 11: 31,061,406 I306K probably damaging Het
Asic4 T A 1: 75,469,102 probably benign Het
B020004J07Rik A C 4: 101,835,414 V463G probably damaging Het
Basp1 G T 15: 25,364,862 D16E unknown Het
Cbll1 A T 12: 31,490,540 I123N probably damaging Het
Ccdc141 A T 2: 77,039,493 H889Q probably benign Het
Ccdc65 T C 15: 98,721,049 V303A probably benign Het
Ceacam20 T A 7: 19,986,668 M60K probably damaging Het
Chd9 T A 8: 90,998,595 V711D probably damaging Het
Clcn1 T A 6: 42,313,045 probably null Het
Col16a1 A T 4: 130,068,475 probably benign Het
Col4a3 C A 1: 82,716,363 P1568Q possibly damaging Het
Colec12 C A 18: 9,858,650 P478T probably damaging Het
Dchs1 T C 7: 105,758,778 H1949R probably damaging Het
Dgka A G 10: 128,737,007 probably null Het
Dlgap4 A G 2: 156,746,191 I669V probably benign Het
Dsg1c T A 18: 20,279,241 D543E probably benign Het
Egflam A T 15: 7,242,425 C677* probably null Het
Eml5 A C 12: 98,824,772 probably null Het
Fbn1 G A 2: 125,389,249 R466C probably damaging Het
Fnbp1 C A 2: 31,058,978 D198Y probably damaging Het
Gfra3 T A 18: 34,691,615 M272L probably benign Het
Gm5422 T A 10: 31,250,160 noncoding transcript Het
Gpr21 T A 2: 37,517,544 I34N probably damaging Het
Hspb2 G T 9: 50,751,364 T155K probably benign Het
Il21r A G 7: 125,625,285 T24A probably benign Het
Mmadhc T A 2: 50,292,835 H43L possibly damaging Het
Morn1 T A 4: 155,111,016 D278E possibly damaging Het
Myoc T C 1: 162,648,674 Y316H probably damaging Het
Nags A G 11: 102,146,979 D266G probably damaging Het
Nlrp4b A G 7: 10,714,215 N115S probably benign Het
Nlrp5 T A 7: 23,417,631 I260N probably damaging Het
Obscn G A 11: 59,036,079 R6190C probably damaging Het
Olfr1105 A G 2: 87,033,468 F251S probably damaging Het
Olfr1449 T C 19: 12,935,260 V174A possibly damaging Het
Orc4 C T 2: 48,917,273 M215I probably benign Het
Otogl A C 10: 107,780,988 N1809K probably benign Het
Pde3a G T 6: 141,492,231 V1009L probably damaging Het
Pign T C 1: 105,653,177 Y159C probably damaging Het
Pik3cg C A 12: 32,197,197 M842I probably damaging Het
Pnliprp1 C T 19: 58,734,882 T235I possibly damaging Het
Prpf8 A G 11: 75,490,654 N239D probably damaging Het
Psd2 T A 18: 35,980,493 probably benign Het
Ptprt T C 2: 161,551,748 D1251G probably damaging Het
Pwp2 G A 10: 78,182,686 S88L probably benign Het
Rassf4 C T 6: 116,647,555 probably benign Het
Rexo1 A G 10: 80,544,850 S884P probably damaging Het
Rgs20 C A 1: 5,020,814 R131L possibly damaging Het
Setd4 A G 16: 93,589,946 V288A probably benign Het
Stx3 G T 19: 11,785,746 T160K probably damaging Het
Tas2r102 T A 6: 132,762,673 S181R probably damaging Het
Tenm3 T C 8: 48,674,399 probably benign Het
Tmem33 T C 5: 67,264,260 probably benign Het
Trim33 A G 3: 103,351,990 probably benign Het
Trip11 A G 12: 101,886,860 I491T probably benign Het
Trp53bp1 A G 2: 121,228,172 probably benign Het
Tuba4a T C 1: 75,216,373 D199G probably benign Het
Zcchc4 A G 5: 52,795,979 Y110C probably damaging Het
Zp2 C T 7: 120,135,470 probably benign Het
Other mutations in Osbpl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Osbpl6 APN 2 76590439 missense probably damaging 1.00
IGL01109:Osbpl6 APN 2 76549527 missense probably damaging 1.00
IGL01288:Osbpl6 APN 2 76564823 missense probably damaging 0.98
IGL01717:Osbpl6 APN 2 76588594 missense probably damaging 1.00
IGL02146:Osbpl6 APN 2 76549750 missense possibly damaging 0.90
IGL02597:Osbpl6 APN 2 76555974 nonsense probably null
IGL02652:Osbpl6 APN 2 76593454 missense probably damaging 1.00
IGL02867:Osbpl6 APN 2 76595870 splice site probably benign
IGL03143:Osbpl6 APN 2 76548372 missense probably damaging 1.00
3-1:Osbpl6 UTSW 2 76586151 missense probably damaging 1.00
R0085:Osbpl6 UTSW 2 76593414 missense probably benign 0.30
R0201:Osbpl6 UTSW 2 76546042 missense possibly damaging 0.92
R0644:Osbpl6 UTSW 2 76594840 missense probably damaging 1.00
R0855:Osbpl6 UTSW 2 76585133 missense probably damaging 1.00
R0855:Osbpl6 UTSW 2 76591839 missense probably damaging 1.00
R1017:Osbpl6 UTSW 2 76549719 missense probably damaging 1.00
R1459:Osbpl6 UTSW 2 76555065 missense probably benign 0.01
R1505:Osbpl6 UTSW 2 76579242 missense probably damaging 1.00
R1588:Osbpl6 UTSW 2 76579216 missense probably benign
R1786:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R1863:Osbpl6 UTSW 2 76585058 missense probably damaging 1.00
R2131:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2132:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2133:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2233:Osbpl6 UTSW 2 76586769 missense probably damaging 0.99
R2235:Osbpl6 UTSW 2 76586769 missense probably damaging 0.99
R2256:Osbpl6 UTSW 2 76584474 missense probably damaging 1.00
R2294:Osbpl6 UTSW 2 76577079 missense possibly damaging 0.81
R3023:Osbpl6 UTSW 2 76586733 missense probably damaging 1.00
R4192:Osbpl6 UTSW 2 76585229 missense probably damaging 1.00
R4544:Osbpl6 UTSW 2 76584492 missense possibly damaging 0.84
R4546:Osbpl6 UTSW 2 76584492 missense possibly damaging 0.84
R4664:Osbpl6 UTSW 2 76568208 missense probably benign 0.02
R4764:Osbpl6 UTSW 2 76546000 missense probably damaging 1.00
R4884:Osbpl6 UTSW 2 76549539 missense probably damaging 1.00
R5080:Osbpl6 UTSW 2 76524085 missense probably benign 0.31
R5430:Osbpl6 UTSW 2 76586138 missense probably damaging 1.00
R5614:Osbpl6 UTSW 2 76568109 missense probably damaging 1.00
R5807:Osbpl6 UTSW 2 76584513 missense probably damaging 0.98
R5956:Osbpl6 UTSW 2 76549512 missense probably damaging 1.00
R6394:Osbpl6 UTSW 2 76555954 missense probably benign 0.00
R6430:Osbpl6 UTSW 2 76579276 missense probably damaging 1.00
R6450:Osbpl6 UTSW 2 76564830 missense possibly damaging 0.90
R7116:Osbpl6 UTSW 2 76595881 missense probably benign 0.06
R7385:Osbpl6 UTSW 2 76549450 missense probably damaging 1.00
R7422:Osbpl6 UTSW 2 76593386 missense probably damaging 1.00
R7561:Osbpl6 UTSW 2 76586154 missense probably damaging 1.00
R7829:Osbpl6 UTSW 2 76593387 missense probably damaging 1.00
Z1177:Osbpl6 UTSW 2 76540179 missense probably benign 0.01
Z31818:Osbpl6 UTSW 2 76555082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACTATACCAGAGGGCCAGAAG -3'
(R):5'- TCAGGACGCAGAACAGCTTTCC -3'

Sequencing Primer
(F):5'- GAGCTTAGCAGCTTTAGGATCATAG -3'
(R):5'- AGAACAGCTTTCCTCTGCTTG -3'
Posted On2013-06-11