Incidental Mutation 'R0573:Trp53bp1'
ID46512
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Nametransformation related protein 53 binding protein 1
Synonyms53BP1, p53BP1
MMRRC Submission 038763-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0573 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121193281-121271407 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 121228172 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000131245]
Predicted Effect probably benign
Transcript: ENSMUST00000110647
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110648
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124031
Predicted Effect probably benign
Transcript: ENSMUST00000131245
SMART Domains Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142400
Predicted Effect probably benign
Transcript: ENSMUST00000147540
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,491,658 K698N possibly damaging Het
Adcy8 A T 15: 64,822,195 V411D probably damaging Het
Arfgef3 T A 10: 18,599,288 E1550V probably damaging Het
Asb3 T A 11: 31,061,406 I306K probably damaging Het
Asic4 T A 1: 75,469,102 probably benign Het
B020004J07Rik A C 4: 101,835,414 V463G probably damaging Het
Basp1 G T 15: 25,364,862 D16E unknown Het
Cbll1 A T 12: 31,490,540 I123N probably damaging Het
Ccdc141 A T 2: 77,039,493 H889Q probably benign Het
Ccdc65 T C 15: 98,721,049 V303A probably benign Het
Ceacam20 T A 7: 19,986,668 M60K probably damaging Het
Chd9 T A 8: 90,998,595 V711D probably damaging Het
Clcn1 T A 6: 42,313,045 probably null Het
Col16a1 A T 4: 130,068,475 probably benign Het
Col4a3 C A 1: 82,716,363 P1568Q possibly damaging Het
Colec12 C A 18: 9,858,650 P478T probably damaging Het
Dchs1 T C 7: 105,758,778 H1949R probably damaging Het
Dgka A G 10: 128,737,007 probably null Het
Dlgap4 A G 2: 156,746,191 I669V probably benign Het
Dsg1c T A 18: 20,279,241 D543E probably benign Het
Egflam A T 15: 7,242,425 C677* probably null Het
Eml5 A C 12: 98,824,772 probably null Het
Fbn1 G A 2: 125,389,249 R466C probably damaging Het
Fnbp1 C A 2: 31,058,978 D198Y probably damaging Het
Gfra3 T A 18: 34,691,615 M272L probably benign Het
Gm5422 T A 10: 31,250,160 noncoding transcript Het
Gpr21 T A 2: 37,517,544 I34N probably damaging Het
Hspb2 G T 9: 50,751,364 T155K probably benign Het
Il21r A G 7: 125,625,285 T24A probably benign Het
Mmadhc T A 2: 50,292,835 H43L possibly damaging Het
Morn1 T A 4: 155,111,016 D278E possibly damaging Het
Myoc T C 1: 162,648,674 Y316H probably damaging Het
Nags A G 11: 102,146,979 D266G probably damaging Het
Nlrp4b A G 7: 10,714,215 N115S probably benign Het
Nlrp5 T A 7: 23,417,631 I260N probably damaging Het
Obscn G A 11: 59,036,079 R6190C probably damaging Het
Olfr1105 A G 2: 87,033,468 F251S probably damaging Het
Olfr1449 T C 19: 12,935,260 V174A possibly damaging Het
Orc4 C T 2: 48,917,273 M215I probably benign Het
Osbpl6 A T 2: 76,590,391 H770L probably damaging Het
Otogl A C 10: 107,780,988 N1809K probably benign Het
Pde3a G T 6: 141,492,231 V1009L probably damaging Het
Pign T C 1: 105,653,177 Y159C probably damaging Het
Pik3cg C A 12: 32,197,197 M842I probably damaging Het
Pnliprp1 C T 19: 58,734,882 T235I possibly damaging Het
Prpf8 A G 11: 75,490,654 N239D probably damaging Het
Psd2 T A 18: 35,980,493 probably benign Het
Ptprt T C 2: 161,551,748 D1251G probably damaging Het
Pwp2 G A 10: 78,182,686 S88L probably benign Het
Rassf4 C T 6: 116,647,555 probably benign Het
Rexo1 A G 10: 80,544,850 S884P probably damaging Het
Rgs20 C A 1: 5,020,814 R131L possibly damaging Het
Setd4 A G 16: 93,589,946 V288A probably benign Het
Stx3 G T 19: 11,785,746 T160K probably damaging Het
Tas2r102 T A 6: 132,762,673 S181R probably damaging Het
Tenm3 T C 8: 48,674,399 probably benign Het
Tmem33 T C 5: 67,264,260 probably benign Het
Trim33 A G 3: 103,351,990 probably benign Het
Trip11 A G 12: 101,886,860 I491T probably benign Het
Tuba4a T C 1: 75,216,373 D199G probably benign Het
Zcchc4 A G 5: 52,795,979 Y110C probably damaging Het
Zp2 C T 7: 120,135,470 probably benign Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121256579 missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121235995 missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121208482 missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121270319 splice site probably null
IGL01639:Trp53bp1 APN 2 121202692 missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121236025 missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121211304 missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121215896 missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121236589 missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121199074 missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121202710 missense possibly damaging 0.67
chives UTSW 2 121251868 missense probably null 0.13
concur UTSW 2 121270319 splice site probably null
confirmation UTSW 2 121205113 critical splice acceptor site probably null
Infra UTSW 2 121247499 critical splice donor site probably null
lentil UTSW 2 121251868 missense probably null 0.13
lentil2 UTSW 2 121207887 missense probably damaging 1.00
Profundus UTSW 2 121207803 missense probably damaging 1.00
split_pea UTSW 2 121228606 nonsense probably null
verily UTSW 2 121211313 missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121271275 missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121204497 missense probably benign
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121270237 missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121204943 missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121236017 missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121269969 missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121227801 missense probably damaging 1.00
R0593:Trp53bp1 UTSW 2 121270528 missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121235707 missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121248264 missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121204318 splice site probably benign
R1377:Trp53bp1 UTSW 2 121270642 missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121236184 missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121252000 missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121205036 missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121204483 missense probably benign
R2143:Trp53bp1 UTSW 2 121216064 missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121270273 nonsense probably null
R2296:Trp53bp1 UTSW 2 121209247 missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121236652 missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121228626 missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121205085 missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121256650 missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121207951 missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121207887 missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121211313 missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121227809 missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121207879 missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121228606 nonsense probably null
R4850:Trp53bp1 UTSW 2 121205113 critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121256641 missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121202603 missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121221220 nonsense probably null
R4962:Trp53bp1 UTSW 2 121270546 missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121270319 splice site probably null
R5111:Trp53bp1 UTSW 2 121211387 missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121216117 missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121243983 missense probably benign 0.40
R5533:Trp53bp1 UTSW 2 121207746 missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121236662 missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121243914 missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121208392 nonsense probably null
R5886:Trp53bp1 UTSW 2 121205021 missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121236823 missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121256602 missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121269945 missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121270612 missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121228603 missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121247499 critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121207803 missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121270576 missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121209309 missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121228666 missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121199113 missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121208040 missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121199035 missense probably damaging 1.00
R7339:Trp53bp1 UTSW 2 121236469 missense probably benign 0.00
R7357:Trp53bp1 UTSW 2 121211300 missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121236346 missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121236638 missense possibly damaging 0.65
R7728:Trp53bp1 UTSW 2 121207899 missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121205061 missense probably damaging 0.99
RF046:Trp53bp1 UTSW 2 121216001 frame shift probably null
Z1088:Trp53bp1 UTSW 2 121253645 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGATCAATTTGCTGTCTGGCTCCAC -3'
(R):5'- TGACCTCACTGCCAAGAGATGAGAG -3'

Sequencing Primer
(F):5'- CACTCTGCAAGATTAAAGAGGGTC -3'
(R):5'- AGAGCGTCAAGTCTGTCTTATCAC -3'
Posted On2013-06-11