Incidental Mutation 'R0573:Dlgap4'
ID46514
Institutional Source Beutler Lab
Gene Symbol Dlgap4
Ensembl Gene ENSMUSG00000061689
Gene NameDLG associated protein 4
SynonymsSAP90/PSD-95-associated protein 4, WBP16, PSD-95/SAP90 binding protein 4, Sapap4, DAP4
MMRRC Submission 038763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R0573 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156613705-156764363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156746191 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 669 (I669V)
Ref Sequence ENSEMBL: ENSMUSP00000126980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000094] [ENSMUST00000070782] [ENSMUST00000099145] [ENSMUST00000109566] [ENSMUST00000109567] [ENSMUST00000109568] [ENSMUST00000131157] [ENSMUST00000137356] [ENSMUST00000146412] [ENSMUST00000169464] [ENSMUST00000171030] [ENSMUST00000177013]
Predicted Effect probably benign
Transcript: ENSMUST00000000094
SMART Domains Protein: ENSMUSP00000000094
Gene: ENSMUSG00000061689

DomainStartEndE-ValueType
Pfam:GKAP 3 232 2.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070782
AA Change: I669V

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000068745
Gene: ENSMUSG00000061689
AA Change: I669V

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
Pfam:GKAP 638 989 1.2e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099145
AA Change: I130V

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096749
Gene: ENSMUSG00000061689
AA Change: I130V

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
low complexity region 61 81 N/A INTRINSIC
low complexity region 89 98 N/A INTRINSIC
Pfam:GKAP 114 453 2.4e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109566
SMART Domains Protein: ENSMUSP00000105194
Gene: ENSMUSG00000061689

DomainStartEndE-ValueType
Pfam:GKAP 1 285 2e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109567
AA Change: I669V

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105195
Gene: ENSMUSG00000061689
AA Change: I669V

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
Pfam:GKAP 636 989 4.4e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109568
AA Change: I652V

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105196
Gene: ENSMUSG00000061689
AA Change: I652V

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 463 480 N/A INTRINSIC
low complexity region 510 537 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 583 603 N/A INTRINSIC
low complexity region 611 620 N/A INTRINSIC
Pfam:GKAP 636 975 5.6e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127944
Predicted Effect probably benign
Transcript: ENSMUST00000131157
SMART Domains Protein: ENSMUSP00000134941
Gene: ENSMUSG00000061689

DomainStartEndE-ValueType
Pfam:GKAP 1 110 2.2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137356
Predicted Effect probably benign
Transcript: ENSMUST00000146412
SMART Domains Protein: ENSMUSP00000135156
Gene: ENSMUSG00000061689

DomainStartEndE-ValueType
Pfam:GKAP 1 122 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169464
AA Change: I669V

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126980
Gene: ENSMUSG00000061689
AA Change: I669V

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
Pfam:GKAP 660 992 1.5e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171030
SMART Domains Protein: ENSMUSP00000129756
Gene: ENSMUSG00000061689

DomainStartEndE-ValueType
Pfam:GKAP 1 266 8.7e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177013
SMART Domains Protein: ENSMUSP00000135409
Gene: ENSMUSG00000061689

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Meta Mutation Damage Score 0.0975 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene encodes a membrane-associated guanylate kinase found at the postsynaptic density in neuronal cells. The encoded protein may play a role in synapse organization and neuronal signalling. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,491,658 K698N possibly damaging Het
Adcy8 A T 15: 64,822,195 V411D probably damaging Het
Arfgef3 T A 10: 18,599,288 E1550V probably damaging Het
Asb3 T A 11: 31,061,406 I306K probably damaging Het
Asic4 T A 1: 75,469,102 probably benign Het
B020004J07Rik A C 4: 101,835,414 V463G probably damaging Het
Basp1 G T 15: 25,364,862 D16E unknown Het
Cbll1 A T 12: 31,490,540 I123N probably damaging Het
Ccdc141 A T 2: 77,039,493 H889Q probably benign Het
Ccdc65 T C 15: 98,721,049 V303A probably benign Het
Ceacam20 T A 7: 19,986,668 M60K probably damaging Het
Chd9 T A 8: 90,998,595 V711D probably damaging Het
Clcn1 T A 6: 42,313,045 probably null Het
Col16a1 A T 4: 130,068,475 probably benign Het
Col4a3 C A 1: 82,716,363 P1568Q possibly damaging Het
Colec12 C A 18: 9,858,650 P478T probably damaging Het
Dchs1 T C 7: 105,758,778 H1949R probably damaging Het
Dgka A G 10: 128,737,007 probably null Het
Dsg1c T A 18: 20,279,241 D543E probably benign Het
Egflam A T 15: 7,242,425 C677* probably null Het
Eml5 A C 12: 98,824,772 probably null Het
Fbn1 G A 2: 125,389,249 R466C probably damaging Het
Fnbp1 C A 2: 31,058,978 D198Y probably damaging Het
Gfra3 T A 18: 34,691,615 M272L probably benign Het
Gm5422 T A 10: 31,250,160 noncoding transcript Het
Gpr21 T A 2: 37,517,544 I34N probably damaging Het
Hspb2 G T 9: 50,751,364 T155K probably benign Het
Il21r A G 7: 125,625,285 T24A probably benign Het
Mmadhc T A 2: 50,292,835 H43L possibly damaging Het
Morn1 T A 4: 155,111,016 D278E possibly damaging Het
Myoc T C 1: 162,648,674 Y316H probably damaging Het
Nags A G 11: 102,146,979 D266G probably damaging Het
Nlrp4b A G 7: 10,714,215 N115S probably benign Het
Nlrp5 T A 7: 23,417,631 I260N probably damaging Het
Obscn G A 11: 59,036,079 R6190C probably damaging Het
Olfr1105 A G 2: 87,033,468 F251S probably damaging Het
Olfr1449 T C 19: 12,935,260 V174A possibly damaging Het
Orc4 C T 2: 48,917,273 M215I probably benign Het
Osbpl6 A T 2: 76,590,391 H770L probably damaging Het
Otogl A C 10: 107,780,988 N1809K probably benign Het
Pde3a G T 6: 141,492,231 V1009L probably damaging Het
Pign T C 1: 105,653,177 Y159C probably damaging Het
Pik3cg C A 12: 32,197,197 M842I probably damaging Het
Pnliprp1 C T 19: 58,734,882 T235I possibly damaging Het
Prpf8 A G 11: 75,490,654 N239D probably damaging Het
Psd2 T A 18: 35,980,493 probably benign Het
Ptprt T C 2: 161,551,748 D1251G probably damaging Het
Pwp2 G A 10: 78,182,686 S88L probably benign Het
Rassf4 C T 6: 116,647,555 probably benign Het
Rexo1 A G 10: 80,544,850 S884P probably damaging Het
Rgs20 C A 1: 5,020,814 R131L possibly damaging Het
Setd4 A G 16: 93,589,946 V288A probably benign Het
Stx3 G T 19: 11,785,746 T160K probably damaging Het
Tas2r102 T A 6: 132,762,673 S181R probably damaging Het
Tenm3 T C 8: 48,674,399 probably benign Het
Tmem33 T C 5: 67,264,260 probably benign Het
Trim33 A G 3: 103,351,990 probably benign Het
Trip11 A G 12: 101,886,860 I491T probably benign Het
Trp53bp1 A G 2: 121,228,172 probably benign Het
Tuba4a T C 1: 75,216,373 D199G probably benign Het
Zcchc4 A G 5: 52,795,979 Y110C probably damaging Het
Zp2 C T 7: 120,135,470 probably benign Het
Other mutations in Dlgap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:Dlgap4 APN 2 156711139 missense probably damaging 1.00
IGL02732:Dlgap4 APN 2 156749323 missense probably benign 0.30
IGL02868:Dlgap4 APN 2 156700896 missense probably damaging 1.00
IGL03169:Dlgap4 APN 2 156711018 splice site probably null
IGL03220:Dlgap4 APN 2 156704626 missense probably damaging 1.00
E0374:Dlgap4 UTSW 2 156761843 missense probably damaging 1.00
R0413:Dlgap4 UTSW 2 156762826 missense probably damaging 1.00
R0645:Dlgap4 UTSW 2 156761879 missense probably damaging 1.00
R0893:Dlgap4 UTSW 2 156745978 nonsense probably null
R1472:Dlgap4 UTSW 2 156760901 nonsense probably null
R1620:Dlgap4 UTSW 2 156749136 nonsense probably null
R1636:Dlgap4 UTSW 2 156746077 nonsense probably null
R2078:Dlgap4 UTSW 2 156762826 missense probably damaging 1.00
R2173:Dlgap4 UTSW 2 156762812 missense probably damaging 1.00
R2264:Dlgap4 UTSW 2 156701463 missense probably benign 0.00
R2348:Dlgap4 UTSW 2 156701206 missense possibly damaging 0.80
R3608:Dlgap4 UTSW 2 156748412 intron probably benign
R3872:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3873:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3874:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3897:Dlgap4 UTSW 2 156746069 missense probably damaging 1.00
R5068:Dlgap4 UTSW 2 156707111 missense probably benign
R5286:Dlgap4 UTSW 2 156745919 missense probably damaging 1.00
R5302:Dlgap4 UTSW 2 156760898 missense probably damaging 1.00
R5568:Dlgap4 UTSW 2 156762901 makesense probably null
R5691:Dlgap4 UTSW 2 156704470 missense probably benign
R5741:Dlgap4 UTSW 2 156711048 missense probably damaging 1.00
R5917:Dlgap4 UTSW 2 156704540 missense probably damaging 1.00
R6140:Dlgap4 UTSW 2 156762729 unclassified probably null
R6992:Dlgap4 UTSW 2 156748940 splice site probably null
R7082:Dlgap4 UTSW 2 156748422 critical splice donor site probably null
R7566:Dlgap4 UTSW 2 156762737 missense probably benign 0.00
R7698:Dlgap4 UTSW 2 156749095 nonsense probably null
R7767:Dlgap4 UTSW 2 156746053 missense probably damaging 1.00
R7853:Dlgap4 UTSW 2 156705882 missense probably benign
R7936:Dlgap4 UTSW 2 156705882 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCATCTCAGTCACCGTCCAGAGC -3'
(R):5'- TTTAGCCACTTGGGGCAGATGCAC -3'

Sequencing Primer
(F):5'- AGTACTGAGTCTGCTCAGGATACC -3'
(R):5'- GGCAGATGCACCAGAATAGAC -3'
Posted On2013-06-11