Incidental Mutation 'R0573:Trim33'
ID46516
Institutional Source Beutler Lab
Gene Symbol Trim33
Ensembl Gene ENSMUSG00000033014
Gene Nametripartite motif-containing 33
Synonymsectodermin, Ecto, 8030451N04Rik, Tif1g
MMRRC Submission 038763-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0573 (G1)
Quality Score160
Status Validated
Chromosome3
Chromosomal Location103279293-103358775 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 103351990 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860] [ENSMUST00000198706]
Predicted Effect probably benign
Transcript: ENSMUST00000029444
SMART Domains Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1095 3.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106860
SMART Domains Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1078 3.52e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197365
Predicted Effect probably benign
Transcript: ENSMUST00000198706
SMART Domains Protein: ENSMUSP00000142585
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
Blast:BBC 1 30 9e-11 BLAST
low complexity region 111 154 N/A INTRINSIC
low complexity region 302 344 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,491,658 K698N possibly damaging Het
Adcy8 A T 15: 64,822,195 V411D probably damaging Het
Arfgef3 T A 10: 18,599,288 E1550V probably damaging Het
Asb3 T A 11: 31,061,406 I306K probably damaging Het
Asic4 T A 1: 75,469,102 probably benign Het
B020004J07Rik A C 4: 101,835,414 V463G probably damaging Het
Basp1 G T 15: 25,364,862 D16E unknown Het
Cbll1 A T 12: 31,490,540 I123N probably damaging Het
Ccdc141 A T 2: 77,039,493 H889Q probably benign Het
Ccdc65 T C 15: 98,721,049 V303A probably benign Het
Ceacam20 T A 7: 19,986,668 M60K probably damaging Het
Chd9 T A 8: 90,998,595 V711D probably damaging Het
Clcn1 T A 6: 42,313,045 probably null Het
Col16a1 A T 4: 130,068,475 probably benign Het
Col4a3 C A 1: 82,716,363 P1568Q possibly damaging Het
Colec12 C A 18: 9,858,650 P478T probably damaging Het
Dchs1 T C 7: 105,758,778 H1949R probably damaging Het
Dgka A G 10: 128,737,007 probably null Het
Dlgap4 A G 2: 156,746,191 I669V probably benign Het
Dsg1c T A 18: 20,279,241 D543E probably benign Het
Egflam A T 15: 7,242,425 C677* probably null Het
Eml5 A C 12: 98,824,772 probably null Het
Fbn1 G A 2: 125,389,249 R466C probably damaging Het
Fnbp1 C A 2: 31,058,978 D198Y probably damaging Het
Gfra3 T A 18: 34,691,615 M272L probably benign Het
Gm5422 T A 10: 31,250,160 noncoding transcript Het
Gpr21 T A 2: 37,517,544 I34N probably damaging Het
Hspb2 G T 9: 50,751,364 T155K probably benign Het
Il21r A G 7: 125,625,285 T24A probably benign Het
Mmadhc T A 2: 50,292,835 H43L possibly damaging Het
Morn1 T A 4: 155,111,016 D278E possibly damaging Het
Myoc T C 1: 162,648,674 Y316H probably damaging Het
Nags A G 11: 102,146,979 D266G probably damaging Het
Nlrp4b A G 7: 10,714,215 N115S probably benign Het
Nlrp5 T A 7: 23,417,631 I260N probably damaging Het
Obscn G A 11: 59,036,079 R6190C probably damaging Het
Olfr1105 A G 2: 87,033,468 F251S probably damaging Het
Olfr1449 T C 19: 12,935,260 V174A possibly damaging Het
Orc4 C T 2: 48,917,273 M215I probably benign Het
Osbpl6 A T 2: 76,590,391 H770L probably damaging Het
Otogl A C 10: 107,780,988 N1809K probably benign Het
Pde3a G T 6: 141,492,231 V1009L probably damaging Het
Pign T C 1: 105,653,177 Y159C probably damaging Het
Pik3cg C A 12: 32,197,197 M842I probably damaging Het
Pnliprp1 C T 19: 58,734,882 T235I possibly damaging Het
Prpf8 A G 11: 75,490,654 N239D probably damaging Het
Psd2 T A 18: 35,980,493 probably benign Het
Ptprt T C 2: 161,551,748 D1251G probably damaging Het
Pwp2 G A 10: 78,182,686 S88L probably benign Het
Rassf4 C T 6: 116,647,555 probably benign Het
Rexo1 A G 10: 80,544,850 S884P probably damaging Het
Rgs20 C A 1: 5,020,814 R131L possibly damaging Het
Setd4 A G 16: 93,589,946 V288A probably benign Het
Stx3 G T 19: 11,785,746 T160K probably damaging Het
Tas2r102 T A 6: 132,762,673 S181R probably damaging Het
Tenm3 T C 8: 48,674,399 probably benign Het
Tmem33 T C 5: 67,264,260 probably benign Het
Trip11 A G 12: 101,886,860 I491T probably benign Het
Trp53bp1 A G 2: 121,228,172 probably benign Het
Tuba4a T C 1: 75,216,373 D199G probably benign Het
Zcchc4 A G 5: 52,795,979 Y110C probably damaging Het
Zp2 C T 7: 120,135,470 probably benign Het
Other mutations in Trim33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Trim33 APN 3 103330182 missense probably benign 0.44
IGL00981:Trim33 APN 3 103351995 splice site probably benign
IGL01010:Trim33 APN 3 103346715 nonsense probably null
IGL01025:Trim33 APN 3 103353918 utr 3 prime probably benign
IGL01082:Trim33 APN 3 103326859 missense possibly damaging 0.49
IGL02245:Trim33 APN 3 103346770 critical splice donor site probably null
IGL02291:Trim33 APN 3 103326865 missense probably damaging 1.00
IGL03248:Trim33 APN 3 103310973 unclassified probably benign
IGL03400:Trim33 APN 3 103329143 missense probably damaging 0.99
abilene UTSW 3 103321559 missense probably damaging 0.99
Bemoaned UTSW 3 103326793 missense possibly damaging 0.92
Excision UTSW 3 103344576 missense probably damaging 1.00
Peaked UTSW 3 103337532 critical splice donor site probably null
Pike UTSW 3 103310885 missense probably damaging 0.98
westworld UTSW 3 103326901 missense possibly damaging 0.46
R0143:Trim33 UTSW 3 103352101 missense probably benign 0.00
R0471:Trim33 UTSW 3 103326901 missense possibly damaging 0.46
R0513:Trim33 UTSW 3 103310384 missense probably damaging 1.00
R0586:Trim33 UTSW 3 103310344 missense probably damaging 0.99
R1103:Trim33 UTSW 3 103310885 missense probably damaging 0.98
R1157:Trim33 UTSW 3 103353830 missense probably damaging 1.00
R1328:Trim33 UTSW 3 103353597 missense possibly damaging 0.86
R1331:Trim33 UTSW 3 103310354 missense probably damaging 0.99
R1385:Trim33 UTSW 3 103310950 missense possibly damaging 0.46
R1397:Trim33 UTSW 3 103310434 unclassified probably benign
R1785:Trim33 UTSW 3 103329220 frame shift probably null
R1848:Trim33 UTSW 3 103324640 unclassified probably benign
R1903:Trim33 UTSW 3 103337444 missense probably damaging 1.00
R3404:Trim33 UTSW 3 103321559 missense probably damaging 0.99
R3878:Trim33 UTSW 3 103352005 missense probably damaging 1.00
R4156:Trim33 UTSW 3 103310314 missense possibly damaging 0.94
R4281:Trim33 UTSW 3 103329086 missense probably damaging 0.99
R4570:Trim33 UTSW 3 103330165 missense probably damaging 0.96
R4809:Trim33 UTSW 3 103329256 missense possibly damaging 0.91
R4904:Trim33 UTSW 3 103331647 missense possibly damaging 0.46
R5168:Trim33 UTSW 3 103341681 nonsense probably null
R5458:Trim33 UTSW 3 103330180 missense possibly damaging 0.64
R5910:Trim33 UTSW 3 103344576 missense probably damaging 1.00
R6195:Trim33 UTSW 3 103337532 critical splice donor site probably null
R6331:Trim33 UTSW 3 103341609 missense probably benign 0.00
R6636:Trim33 UTSW 3 103353719 missense probably damaging 1.00
R6642:Trim33 UTSW 3 103337514 missense probably damaging 0.99
R6783:Trim33 UTSW 3 103352087 missense probably damaging 1.00
R6856:Trim33 UTSW 3 103352049 missense probably damaging 0.97
R7220:Trim33 UTSW 3 103326793 missense possibly damaging 0.92
R7325:Trim33 UTSW 3 103321636 missense possibly damaging 0.93
R7374:Trim33 UTSW 3 103310323 missense probably damaging 0.98
R7430:Trim33 UTSW 3 103310903 missense possibly damaging 0.92
R7438:Trim33 UTSW 3 103346640 splice site probably benign
R7491:Trim33 UTSW 3 103326148 missense probably benign 0.28
R8001:Trim33 UTSW 3 103311515 critical splice donor site probably null
RF005:Trim33 UTSW 3 103280212 frame shift probably null
RF007:Trim33 UTSW 3 103280217 small deletion probably benign
RF014:Trim33 UTSW 3 103329092 missense possibly damaging 0.94
RF061:Trim33 UTSW 3 103280217 small deletion probably benign
RF064:Trim33 UTSW 3 103280195 frame shift probably null
Z1176:Trim33 UTSW 3 103353727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACTTAGAGTAACCATTCGAACCAGCA -3'
(R):5'- TCACAGTTCTTGAAGATCAAACGGACAT -3'

Sequencing Primer
(F):5'- ATTCGAACCAGCATGTATCCTG -3'
(R):5'- GACATCAGCCACAAAGTCATCTG -3'
Posted On2013-06-11