Incidental Mutation 'R0573:Col16a1'
ID46518
Institutional Source Beutler Lab
Gene Symbol Col16a1
Ensembl Gene ENSMUSG00000040690
Gene Namecollagen, type XVI, alpha 1
Synonyms2700007F12Rik, [a]1 (XVI) collagen, A530052M23Rik
MMRRC Submission 038763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0573 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130047840-130099283 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 130068475 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044565] [ENSMUST00000143432] [ENSMUST00000143577]
Predicted Effect probably benign
Transcript: ENSMUST00000044565
SMART Domains Protein: ENSMUSP00000035802
Gene: ENSMUSG00000040690

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_4 330 355 2.35e-7 PROSPERO
Pfam:Collagen 372 431 1.6e-8 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_2 546 562 2.68e-9 PROSPERO
internal_repeat_1 547 580 9.92e-10 PROSPERO
Pfam:Collagen 584 646 1.5e-9 PFAM
internal_repeat_5 662 689 6.35e-7 PROSPERO
internal_repeat_3 662 731 1.96e-8 PROSPERO
internal_repeat_7 679 695 2.06e-5 PROSPERO
internal_repeat_6 682 730 7.63e-6 PROSPERO
internal_repeat_1 685 742 9.92e-10 PROSPERO
Pfam:Collagen 796 850 3.4e-9 PFAM
internal_repeat_5 859 889 6.35e-7 PROSPERO
low complexity region 891 922 N/A INTRINSIC
low complexity region 990 1000 N/A INTRINSIC
Pfam:Collagen 1001 1064 1.4e-10 PFAM
low complexity region 1090 1112 N/A INTRINSIC
internal_repeat_7 1114 1130 2.06e-5 PROSPERO
low complexity region 1132 1162 N/A INTRINSIC
low complexity region 1171 1222 N/A INTRINSIC
low complexity region 1230 1282 N/A INTRINSIC
internal_repeat_2 1283 1299 2.68e-9 PROSPERO
internal_repeat_6 1287 1335 7.63e-6 PROSPERO
Pfam:Collagen 1350 1411 1.8e-9 PFAM
Pfam:Collagen 1446 1503 5.3e-10 PFAM
low complexity region 1505 1525 N/A INTRINSIC
low complexity region 1528 1549 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106001
Predicted Effect probably benign
Transcript: ENSMUST00000143432
SMART Domains Protein: ENSMUSP00000120384
Gene: ENSMUSG00000040690

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_1 330 353 5.41e-8 PROSPERO
Pfam:Collagen 372 426 2.1e-9 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_1 546 569 5.41e-8 PROSPERO
internal_repeat_2 547 580 5.41e-8 PROSPERO
Pfam:Collagen 584 646 2.7e-10 PFAM
Pfam:Collagen 659 736 8.6e-8 PFAM
Pfam:Collagen 745 797 1.6e-7 PFAM
Pfam:Collagen 796 850 5.9e-10 PFAM
Pfam:Collagen 848 923 1.6e-7 PFAM
low complexity region 974 984 N/A INTRINSIC
Pfam:Collagen 987 1045 1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143577
SMART Domains Protein: ENSMUSP00000120339
Gene: ENSMUSG00000040690

DomainStartEndE-ValueType
internal_repeat_7 1 43 5.7e-5 PROSPERO
Pfam:Collagen 57 112 2e-9 PFAM
low complexity region 126 192 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 231 247 1.5e-10 PROSPERO
internal_repeat_1 232 265 5.16e-11 PROSPERO
Pfam:Collagen 269 331 3.4e-10 PFAM
Pfam:Collagen 360 421 7e-11 PFAM
Pfam:Collagen 430 482 1.9e-7 PFAM
Pfam:Collagen 481 535 7.8e-10 PFAM
Pfam:Collagen 560 623 1.4e-7 PFAM
internal_repeat_9 640 665 9.73e-5 PROSPERO
low complexity region 675 685 N/A INTRINSIC
Pfam:Collagen 686 747 2.5e-11 PFAM
Pfam:Collagen 730 802 5.2e-9 PFAM
Pfam:Collagen 783 860 9.2e-9 PFAM
low complexity region 871 922 N/A INTRINSIC
low complexity region 930 985 N/A INTRINSIC
internal_repeat_2 986 1002 1.5e-10 PROSPERO
internal_repeat_5 990 1038 7.88e-7 PROSPERO
low complexity region 1041 1110 N/A INTRINSIC
Pfam:Collagen 1149 1205 1.8e-10 PFAM
Pfam:Collagen 1203 1260 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146606
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVI collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. High levels of type XVI collagen have been found in fibroblasts and keratinocytes, and in smooth muscle and amnion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,491,658 K698N possibly damaging Het
Adcy8 A T 15: 64,822,195 V411D probably damaging Het
Arfgef3 T A 10: 18,599,288 E1550V probably damaging Het
Asb3 T A 11: 31,061,406 I306K probably damaging Het
Asic4 T A 1: 75,469,102 probably benign Het
B020004J07Rik A C 4: 101,835,414 V463G probably damaging Het
Basp1 G T 15: 25,364,862 D16E unknown Het
Cbll1 A T 12: 31,490,540 I123N probably damaging Het
Ccdc141 A T 2: 77,039,493 H889Q probably benign Het
Ccdc65 T C 15: 98,721,049 V303A probably benign Het
Ceacam20 T A 7: 19,986,668 M60K probably damaging Het
Chd9 T A 8: 90,998,595 V711D probably damaging Het
Clcn1 T A 6: 42,313,045 probably null Het
Col4a3 C A 1: 82,716,363 P1568Q possibly damaging Het
Colec12 C A 18: 9,858,650 P478T probably damaging Het
Dchs1 T C 7: 105,758,778 H1949R probably damaging Het
Dgka A G 10: 128,737,007 probably null Het
Dlgap4 A G 2: 156,746,191 I669V probably benign Het
Dsg1c T A 18: 20,279,241 D543E probably benign Het
Egflam A T 15: 7,242,425 C677* probably null Het
Eml5 A C 12: 98,824,772 probably null Het
Fbn1 G A 2: 125,389,249 R466C probably damaging Het
Fnbp1 C A 2: 31,058,978 D198Y probably damaging Het
Gfra3 T A 18: 34,691,615 M272L probably benign Het
Gm5422 T A 10: 31,250,160 noncoding transcript Het
Gpr21 T A 2: 37,517,544 I34N probably damaging Het
Hspb2 G T 9: 50,751,364 T155K probably benign Het
Il21r A G 7: 125,625,285 T24A probably benign Het
Mmadhc T A 2: 50,292,835 H43L possibly damaging Het
Morn1 T A 4: 155,111,016 D278E possibly damaging Het
Myoc T C 1: 162,648,674 Y316H probably damaging Het
Nags A G 11: 102,146,979 D266G probably damaging Het
Nlrp4b A G 7: 10,714,215 N115S probably benign Het
Nlrp5 T A 7: 23,417,631 I260N probably damaging Het
Obscn G A 11: 59,036,079 R6190C probably damaging Het
Olfr1105 A G 2: 87,033,468 F251S probably damaging Het
Olfr1449 T C 19: 12,935,260 V174A possibly damaging Het
Orc4 C T 2: 48,917,273 M215I probably benign Het
Osbpl6 A T 2: 76,590,391 H770L probably damaging Het
Otogl A C 10: 107,780,988 N1809K probably benign Het
Pde3a G T 6: 141,492,231 V1009L probably damaging Het
Pign T C 1: 105,653,177 Y159C probably damaging Het
Pik3cg C A 12: 32,197,197 M842I probably damaging Het
Pnliprp1 C T 19: 58,734,882 T235I possibly damaging Het
Prpf8 A G 11: 75,490,654 N239D probably damaging Het
Psd2 T A 18: 35,980,493 probably benign Het
Ptprt T C 2: 161,551,748 D1251G probably damaging Het
Pwp2 G A 10: 78,182,686 S88L probably benign Het
Rassf4 C T 6: 116,647,555 probably benign Het
Rexo1 A G 10: 80,544,850 S884P probably damaging Het
Rgs20 C A 1: 5,020,814 R131L possibly damaging Het
Setd4 A G 16: 93,589,946 V288A probably benign Het
Stx3 G T 19: 11,785,746 T160K probably damaging Het
Tas2r102 T A 6: 132,762,673 S181R probably damaging Het
Tenm3 T C 8: 48,674,399 probably benign Het
Tmem33 T C 5: 67,264,260 probably benign Het
Trim33 A G 3: 103,351,990 probably benign Het
Trip11 A G 12: 101,886,860 I491T probably benign Het
Trp53bp1 A G 2: 121,228,172 probably benign Het
Tuba4a T C 1: 75,216,373 D199G probably benign Het
Zcchc4 A G 5: 52,795,979 Y110C probably damaging Het
Zp2 C T 7: 120,135,470 probably benign Het
Other mutations in Col16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Col16a1 APN 4 130094552 splice site probably null
IGL00885:Col16a1 APN 4 130096910 missense probably damaging 1.00
IGL01931:Col16a1 APN 4 130072841 missense possibly damaging 0.47
IGL02142:Col16a1 APN 4 130051647 splice site probably null
IGL02307:Col16a1 APN 4 130059009 missense probably damaging 1.00
IGL02731:Col16a1 APN 4 130053530 unclassified probably benign
IGL02742:Col16a1 APN 4 130061379 unclassified probably benign
PIT4520001:Col16a1 UTSW 4 130051663 missense unknown
R0127:Col16a1 UTSW 4 130052857 missense probably damaging 1.00
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0132:Col16a1 UTSW 4 130067096 missense unknown
R0299:Col16a1 UTSW 4 130058318 frame shift probably null
R0355:Col16a1 UTSW 4 130058413 splice site probably benign
R0395:Col16a1 UTSW 4 130073109 missense probably damaging 1.00
R0485:Col16a1 UTSW 4 130090497 splice site probably benign
R1274:Col16a1 UTSW 4 130097801 missense probably damaging 0.98
R1619:Col16a1 UTSW 4 130098940 missense probably damaging 1.00
R1759:Col16a1 UTSW 4 130084269 missense probably damaging 1.00
R1832:Col16a1 UTSW 4 130077057 splice site probably null
R1861:Col16a1 UTSW 4 130061724 unclassified probably benign
R1862:Col16a1 UTSW 4 130092782 critical splice donor site probably null
R1981:Col16a1 UTSW 4 130065443 missense unknown
R2265:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2269:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2291:Col16a1 UTSW 4 130067040 missense unknown
R3176:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3276:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3552:Col16a1 UTSW 4 130077041 missense probably benign 0.10
R4049:Col16a1 UTSW 4 130068752 missense probably damaging 1.00
R4241:Col16a1 UTSW 4 130099050 missense probably damaging 0.98
R4327:Col16a1 UTSW 4 130094551 critical splice donor site probably null
R4591:Col16a1 UTSW 4 130061799 splice site probably null
R4664:Col16a1 UTSW 4 130062090 unclassified probably benign
R4803:Col16a1 UTSW 4 130055108 unclassified probably benign
R4925:Col16a1 UTSW 4 130054176 missense probably damaging 1.00
R4961:Col16a1 UTSW 4 130054479 splice site probably null
R5016:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5027:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5085:Col16a1 UTSW 4 130054171 missense probably damaging 1.00
R5088:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5089:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5408:Col16a1 UTSW 4 130093105 utr 3 prime probably benign
R5472:Col16a1 UTSW 4 130092771 utr 3 prime probably benign
R5564:Col16a1 UTSW 4 130053358 missense probably damaging 1.00
R5597:Col16a1 UTSW 4 130058304 missense probably damaging 1.00
R5703:Col16a1 UTSW 4 130053299 missense probably damaging 0.96
R6054:Col16a1 UTSW 4 130061722 unclassified probably benign
R6226:Col16a1 UTSW 4 130055089 unclassified probably benign
R6362:Col16a1 UTSW 4 130066190 missense unknown
R6448:Col16a1 UTSW 4 130058988 missense probably damaging 1.00
R6449:Col16a1 UTSW 4 130066693 missense unknown
R6502:Col16a1 UTSW 4 130055994 missense probably damaging 1.00
R6949:Col16a1 UTSW 4 130059323 missense probably damaging 1.00
R6969:Col16a1 UTSW 4 130093087 utr 3 prime probably benign
R7086:Col16a1 UTSW 4 130052980 splice site probably null
R7375:Col16a1 UTSW 4 130065501 missense unknown
R7703:Col16a1 UTSW 4 130096502 missense unknown
R7808:Col16a1 UTSW 4 130073264 missense unknown
RF014:Col16a1 UTSW 4 130093067 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGAGTTGGGACTGGCAGACAC -3'
(R):5'- ATGGTTTGAAGCCAGCACTGAGATG -3'

Sequencing Primer
(F):5'- AGATCTGCCAGTGACACAG -3'
(R):5'- TGTACTGAATGGATCTCAGGCAC -3'
Posted On2013-06-11