Incidental Mutation 'R0573:Rassf4'
ID46523
Institutional Source Beutler Lab
Gene Symbol Rassf4
Ensembl Gene ENSMUSG00000042129
Gene NameRas association (RalGDS/AF-6) domain family member 4
Synonyms3830411C14Rik
MMRRC Submission 038763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R0573 (G1)
Quality Score198
Status Validated
Chromosome6
Chromosomal Location116633008-116673952 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 116647555 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035842] [ENSMUST00000067354] [ENSMUST00000178241] [ENSMUST00000203029] [ENSMUST00000204203] [ENSMUST00000204555] [ENSMUST00000204576]
Predicted Effect probably benign
Transcript: ENSMUST00000035842
SMART Domains Protein: ENSMUSP00000048267
Gene: ENSMUSG00000042129

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
RA 173 263 1.36e-15 SMART
Pfam:Nore1-SARAH 276 315 1.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067354
SMART Domains Protein: ENSMUSP00000070203
Gene: ENSMUSG00000048489

DomainStartEndE-ValueType
Pfam:DEPP 25 205 1.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178241
SMART Domains Protein: ENSMUSP00000136165
Gene: ENSMUSG00000048489

DomainStartEndE-ValueType
Pfam:DEPP 25 205 5.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184219
Predicted Effect probably benign
Transcript: ENSMUST00000203029
SMART Domains Protein: ENSMUSP00000144786
Gene: ENSMUSG00000042129

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
RA 173 263 8.7e-18 SMART
Pfam:Nore1-SARAH 276 303 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203634
Predicted Effect probably benign
Transcript: ENSMUST00000204203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204313
Predicted Effect probably benign
Transcript: ENSMUST00000204555
SMART Domains Protein: ENSMUSP00000145125
Gene: ENSMUSG00000048489

DomainStartEndE-ValueType
Pfam:DEPP 25 70 3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204576
SMART Domains Protein: ENSMUSP00000145394
Gene: ENSMUSG00000042129

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene has not yet been determined but may involve a role in tumor suppression. Alternative splicing of this gene results in several transcript variants; however, most of the variants have not been fully described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,491,658 K698N possibly damaging Het
Adcy8 A T 15: 64,822,195 V411D probably damaging Het
Arfgef3 T A 10: 18,599,288 E1550V probably damaging Het
Asb3 T A 11: 31,061,406 I306K probably damaging Het
Asic4 T A 1: 75,469,102 probably benign Het
B020004J07Rik A C 4: 101,835,414 V463G probably damaging Het
Basp1 G T 15: 25,364,862 D16E unknown Het
Cbll1 A T 12: 31,490,540 I123N probably damaging Het
Ccdc141 A T 2: 77,039,493 H889Q probably benign Het
Ccdc65 T C 15: 98,721,049 V303A probably benign Het
Ceacam20 T A 7: 19,986,668 M60K probably damaging Het
Chd9 T A 8: 90,998,595 V711D probably damaging Het
Clcn1 T A 6: 42,313,045 probably null Het
Col16a1 A T 4: 130,068,475 probably benign Het
Col4a3 C A 1: 82,716,363 P1568Q possibly damaging Het
Colec12 C A 18: 9,858,650 P478T probably damaging Het
Dchs1 T C 7: 105,758,778 H1949R probably damaging Het
Dgka A G 10: 128,737,007 probably null Het
Dlgap4 A G 2: 156,746,191 I669V probably benign Het
Dsg1c T A 18: 20,279,241 D543E probably benign Het
Egflam A T 15: 7,242,425 C677* probably null Het
Eml5 A C 12: 98,824,772 probably null Het
Fbn1 G A 2: 125,389,249 R466C probably damaging Het
Fnbp1 C A 2: 31,058,978 D198Y probably damaging Het
Gfra3 T A 18: 34,691,615 M272L probably benign Het
Gm5422 T A 10: 31,250,160 noncoding transcript Het
Gpr21 T A 2: 37,517,544 I34N probably damaging Het
Hspb2 G T 9: 50,751,364 T155K probably benign Het
Il21r A G 7: 125,625,285 T24A probably benign Het
Mmadhc T A 2: 50,292,835 H43L possibly damaging Het
Morn1 T A 4: 155,111,016 D278E possibly damaging Het
Myoc T C 1: 162,648,674 Y316H probably damaging Het
Nags A G 11: 102,146,979 D266G probably damaging Het
Nlrp4b A G 7: 10,714,215 N115S probably benign Het
Nlrp5 T A 7: 23,417,631 I260N probably damaging Het
Obscn G A 11: 59,036,079 R6190C probably damaging Het
Olfr1105 A G 2: 87,033,468 F251S probably damaging Het
Olfr1449 T C 19: 12,935,260 V174A possibly damaging Het
Orc4 C T 2: 48,917,273 M215I probably benign Het
Osbpl6 A T 2: 76,590,391 H770L probably damaging Het
Otogl A C 10: 107,780,988 N1809K probably benign Het
Pde3a G T 6: 141,492,231 V1009L probably damaging Het
Pign T C 1: 105,653,177 Y159C probably damaging Het
Pik3cg C A 12: 32,197,197 M842I probably damaging Het
Pnliprp1 C T 19: 58,734,882 T235I possibly damaging Het
Prpf8 A G 11: 75,490,654 N239D probably damaging Het
Psd2 T A 18: 35,980,493 probably benign Het
Ptprt T C 2: 161,551,748 D1251G probably damaging Het
Pwp2 G A 10: 78,182,686 S88L probably benign Het
Rexo1 A G 10: 80,544,850 S884P probably damaging Het
Rgs20 C A 1: 5,020,814 R131L possibly damaging Het
Setd4 A G 16: 93,589,946 V288A probably benign Het
Stx3 G T 19: 11,785,746 T160K probably damaging Het
Tas2r102 T A 6: 132,762,673 S181R probably damaging Het
Tenm3 T C 8: 48,674,399 probably benign Het
Tmem33 T C 5: 67,264,260 probably benign Het
Trim33 A G 3: 103,351,990 probably benign Het
Trip11 A G 12: 101,886,860 I491T probably benign Het
Trp53bp1 A G 2: 121,228,172 probably benign Het
Tuba4a T C 1: 75,216,373 D199G probably benign Het
Zcchc4 A G 5: 52,795,979 Y110C probably damaging Het
Zp2 C T 7: 120,135,470 probably benign Het
Other mutations in Rassf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Rassf4 APN 6 116645128 missense possibly damaging 0.47
IGL01132:Rassf4 APN 6 116659607 splice site probably benign
IGL01637:Rassf4 APN 6 116641690 missense probably damaging 1.00
IGL02000:Rassf4 APN 6 116645972 missense probably benign 0.20
IGL02748:Rassf4 APN 6 116639457 missense possibly damaging 0.93
IGL02976:Rassf4 APN 6 116638248 missense probably damaging 0.96
IGL03394:Rassf4 APN 6 116641747 missense probably damaging 1.00
R0599:Rassf4 UTSW 6 116645936 missense probably damaging 1.00
R1741:Rassf4 UTSW 6 116639489 missense probably damaging 1.00
R1750:Rassf4 UTSW 6 116640267 missense probably damaging 1.00
R2117:Rassf4 UTSW 6 116645127 missense possibly damaging 0.86
R2369:Rassf4 UTSW 6 116638297 missense probably damaging 0.97
R2916:Rassf4 UTSW 6 116641740 missense probably damaging 1.00
R2918:Rassf4 UTSW 6 116641740 missense probably damaging 1.00
R4829:Rassf4 UTSW 6 116645142 missense possibly damaging 0.80
R5716:Rassf4 UTSW 6 116661867 missense probably benign 0.01
R6769:Rassf4 UTSW 6 116641472 missense possibly damaging 0.95
R7304:Rassf4 UTSW 6 116640317 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCAAAGGTCATATCATCCCAGG -3'
(R):5'- TGTTCCCGAGCAGGTCACAAAG -3'

Sequencing Primer
(F):5'- TCATATCATCCCAGGGAGGGC -3'
(R):5'- GAAATGACTGACCTGTGTTTCTC -3'
Posted On2013-06-11