Mutagenetix > Incidental Mutation

Incidental Mutation 'R0573:Tenm3'

46532

Institutional Source

Beutler Lab

Gene Symbol

Tenm3

Ensembl Gene

ENSMUSG00000031561

Gene Name

teneurin transmembrane protein 3

Synonyms

Ten-m3, Odz3, 2610100B16Rik

MMRRC Submission

038763-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.598) question?

Stock #

R0573 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48227682-48843951 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 48674399 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148666 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840] [ENSMUST00000211812]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000033965

SMART Domains

Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561

Domain	Start	End	E-Value	Type
Pfam:Ten_N	11	177	6.9e-91	PFAM
Pfam:Ten_N	171	308	1e-72	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2631	2708	1.5e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000190840

SMART Domains

Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	182	7.6e-77	PFAM
Pfam:Ten_N	168	308	6.6e-50	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2630	2708	3.2e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211812

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.5%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	A	T	12: 113,491,658	K698N	possibly damaging	Het
Adcy8	A	T	15: 64,822,195	V411D	probably damaging	Het
Arfgef3	T	A	10: 18,599,288	E1550V	probably damaging	Het
Asb3	T	A	11: 31,061,406	I306K	probably damaging	Het
Asic4	T	A	1: 75,469,102		probably benign	Het
B020004J07Rik	A	C	4: 101,835,414	V463G	probably damaging	Het
Basp1	G	T	15: 25,364,862	D16E	unknown	Het
Cbll1	A	T	12: 31,490,540	I123N	probably damaging	Het
Ccdc141	A	T	2: 77,039,493	H889Q	probably benign	Het
Ccdc65	T	C	15: 98,721,049	V303A	probably benign	Het
Ceacam20	T	A	7: 19,986,668	M60K	probably damaging	Het
Chd9	T	A	8: 90,998,595	V711D	probably damaging	Het
Clcn1	T	A	6: 42,313,045		probably null	Het
Col16a1	A	T	4: 130,068,475		probably benign	Het
Col4a3	C	A	1: 82,716,363	P1568Q	possibly damaging	Het
Colec12	C	A	18: 9,858,650	P478T	probably damaging	Het
Dchs1	T	C	7: 105,758,778	H1949R	probably damaging	Het
Dgka	A	G	10: 128,737,007		probably null	Het
Dlgap4	A	G	2: 156,746,191	I669V	probably benign	Het
Dsg1c	T	A	18: 20,279,241	D543E	probably benign	Het
Egflam	A	T	15: 7,242,425	C677*	probably null	Het
Eml5	A	C	12: 98,824,772		probably null	Het
Fbn1	G	A	2: 125,389,249	R466C	probably damaging	Het
Fnbp1	C	A	2: 31,058,978	D198Y	probably damaging	Het
Gfra3	T	A	18: 34,691,615	M272L	probably benign	Het
Gm5422	T	A	10: 31,250,160		noncoding transcript	Het
Gpr21	T	A	2: 37,517,544	I34N	probably damaging	Het
Hspb2	G	T	9: 50,751,364	T155K	probably benign	Het
Il21r	A	G	7: 125,625,285	T24A	probably benign	Het
Mmadhc	T	A	2: 50,292,835	H43L	possibly damaging	Het
Morn1	T	A	4: 155,111,016	D278E	possibly damaging	Het
Myoc	T	C	1: 162,648,674	Y316H	probably damaging	Het
Nags	A	G	11: 102,146,979	D266G	probably damaging	Het
Nlrp4b	A	G	7: 10,714,215	N115S	probably benign	Het
Nlrp5	T	A	7: 23,417,631	I260N	probably damaging	Het
Obscn	G	A	11: 59,036,079	R6190C	probably damaging	Het
Olfr1105	A	G	2: 87,033,468	F251S	probably damaging	Het
Olfr1449	T	C	19: 12,935,260	V174A	possibly damaging	Het
Orc4	C	T	2: 48,917,273	M215I	probably benign	Het
Osbpl6	A	T	2: 76,590,391	H770L	probably damaging	Het
Otogl	A	C	10: 107,780,988	N1809K	probably benign	Het
Pde3a	G	T	6: 141,492,231	V1009L	probably damaging	Het
Pign	T	C	1: 105,653,177	Y159C	probably damaging	Het
Pik3cg	C	A	12: 32,197,197	M842I	probably damaging	Het
Pnliprp1	C	T	19: 58,734,882	T235I	possibly damaging	Het
Prpf8	A	G	11: 75,490,654	N239D	probably damaging	Het
Psd2	T	A	18: 35,980,493		probably benign	Het
Ptprt	T	C	2: 161,551,748	D1251G	probably damaging	Het
Pwp2	G	A	10: 78,182,686	S88L	probably benign	Het
Rassf4	C	T	6: 116,647,555		probably benign	Het
Rexo1	A	G	10: 80,544,850	S884P	probably damaging	Het
Rgs20	C	A	1: 5,020,814	R131L	possibly damaging	Het
Setd4	A	G	16: 93,589,946	V288A	probably benign	Het
Stx3	G	T	19: 11,785,746	T160K	probably damaging	Het
Tas2r102	T	A	6: 132,762,673	S181R	probably damaging	Het
Tmem33	T	C	5: 67,264,260		probably benign	Het
Trim33	A	G	3: 103,351,990		probably benign	Het
Trip11	A	G	12: 101,886,860	I491T	probably benign	Het
Trp53bp1	A	G	2: 121,228,172		probably benign	Het
Tuba4a	T	C	1: 75,216,373	D199G	probably benign	Het
Zcchc4	A	G	5: 52,795,979	Y110C	probably damaging	Het
Zp2	C	T	7: 120,135,470		probably benign	Het

Other mutations in Tenm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Tenm3	APN	8	48417060	missense	probably damaging	1.00
IGL00538:Tenm3	APN	8	48236025	missense	probably damaging	1.00
IGL00719:Tenm3	APN	8	48279042	missense	probably benign	0.39
IGL00720:Tenm3	APN	8	48276421	missense	probably damaging	0.98
IGL00870:Tenm3	APN	8	48417132	missense	probably benign	0.00
IGL00976:Tenm3	APN	8	48256841	missense	probably benign	0.14
IGL01469:Tenm3	APN	8	48236423	missense	probably damaging	1.00
IGL01508:Tenm3	APN	8	48276645	missense	probably benign	0.09
IGL01590:Tenm3	APN	8	48228802	missense	probably damaging	1.00
IGL01610:Tenm3	APN	8	48254477	missense	probably damaging	1.00
IGL01874:Tenm3	APN	8	48236758	nonsense	probably null
IGL01892:Tenm3	APN	8	48276396	missense	probably benign	0.09
IGL02098:Tenm3	APN	8	48276576	missense	possibly damaging	0.94
IGL02382:Tenm3	APN	8	48235476	missense	probably damaging	1.00
IGL02397:Tenm3	APN	8	48236694	missense	possibly damaging	0.94
IGL02475:Tenm3	APN	8	48279198	splice site	probably benign
IGL02502:Tenm3	APN	8	48288016	missense	probably damaging	1.00
IGL02508:Tenm3	APN	8	48299639	missense	probably benign	0.30
IGL02543:Tenm3	APN	8	48298956	missense	probably damaging	1.00
IGL02723:Tenm3	APN	8	48276903	missense	probably benign	0.02
IGL03037:Tenm3	APN	8	48298878	missense	possibly damaging	0.90
IGL03160:Tenm3	APN	8	48646418	missense	probably benign	0.05
IGL03268:Tenm3	APN	8	48235523	missense	probably damaging	1.00
IGL02988:Tenm3	UTSW	8	48235346	missense	probably damaging	0.99
PIT4431001:Tenm3	UTSW	8	48235607	missense	probably damaging	1.00
PIT4504001:Tenm3	UTSW	8	48293657	missense	probably damaging	1.00
R0079:Tenm3	UTSW	8	48343345	missense	possibly damaging	0.90
R0121:Tenm3	UTSW	8	48342659	missense	probably damaging	0.99
R0123:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0134:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0147:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0148:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0309:Tenm3	UTSW	8	48341034	missense	probably damaging	1.00
R0322:Tenm3	UTSW	8	48236912	splice site	probably benign
R0335:Tenm3	UTSW	8	48232105	missense	probably damaging	1.00
R0355:Tenm3	UTSW	8	48228975	missense	probably damaging	1.00
R0411:Tenm3	UTSW	8	48287791	missense	possibly damaging	0.61
R0505:Tenm3	UTSW	8	48341160	splice site	probably benign
R0599:Tenm3	UTSW	8	48277710	missense	probably damaging	1.00
R0616:Tenm3	UTSW	8	48276156	missense	possibly damaging	0.76
R0637:Tenm3	UTSW	8	48236525	missense	probably damaging	1.00
R0726:Tenm3	UTSW	8	48236594	missense	probably damaging	1.00
R0840:Tenm3	UTSW	8	48335742	missense	probably damaging	0.99
R0981:Tenm3	UTSW	8	48298965	missense	probably damaging	1.00
R1006:Tenm3	UTSW	8	48228542	missense	probably damaging	1.00
R1199:Tenm3	UTSW	8	48235582	missense	probably damaging	0.99
R1223:Tenm3	UTSW	8	48240396	missense	possibly damaging	0.72
R1240:Tenm3	UTSW	8	48287893	missense	possibly damaging	0.74
R1394:Tenm3	UTSW	8	48276400	missense	probably benign
R1455:Tenm3	UTSW	8	48279048	missense	possibly damaging	0.87
R1459:Tenm3	UTSW	8	48235971	missense	probably damaging	1.00
R1473:Tenm3	UTSW	8	48310625	missense	probably damaging	1.00
R1501:Tenm3	UTSW	8	48343316	missense	probably damaging	0.99
R1507:Tenm3	UTSW	8	48287822	missense	probably benign	0.01
R1522:Tenm3	UTSW	8	48395576	missense	probably damaging	1.00
R1524:Tenm3	UTSW	8	48228981	missense	possibly damaging	0.92
R1553:Tenm3	UTSW	8	48236421	missense	probably damaging	1.00
R1572:Tenm3	UTSW	8	48228993	missense	possibly damaging	0.94
R1583:Tenm3	UTSW	8	48279074	missense	probably benign	0.09
R1676:Tenm3	UTSW	8	48417119	missense	possibly damaging	0.83
R1732:Tenm3	UTSW	8	48310634	missense	probably damaging	1.00
R1768:Tenm3	UTSW	8	48232104	missense	probably damaging	1.00
R1777:Tenm3	UTSW	8	48417179	missense	probably benign	0.05
R1793:Tenm3	UTSW	8	48674544	missense	probably damaging	0.98
R1801:Tenm3	UTSW	8	48276256	missense	probably benign	0.39
R1863:Tenm3	UTSW	8	48276346	missense	probably benign	0.20
R1898:Tenm3	UTSW	8	48310761	missense	probably damaging	1.00
R1971:Tenm3	UTSW	8	48236313	missense	probably damaging	1.00
R1972:Tenm3	UTSW	8	48228591	missense	probably damaging	1.00
R1996:Tenm3	UTSW	8	48228668	missense	probably damaging	1.00
R2061:Tenm3	UTSW	8	48342256	critical splice donor site	probably null
R2109:Tenm3	UTSW	8	48343349	missense	possibly damaging	0.94
R2124:Tenm3	UTSW	8	48417006	critical splice donor site	probably null
R2190:Tenm3	UTSW	8	48395544	missense	probably damaging	1.00
R2204:Tenm3	UTSW	8	48674550	missense	probably benign	0.17
R2233:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2234:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2235:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2237:Tenm3	UTSW	8	48342337	missense	probably damaging	1.00
R2418:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2419:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2435:Tenm3	UTSW	8	48287953	missense	probably damaging	1.00
R2483:Tenm3	UTSW	8	48240270	missense	probably damaging	0.99
R3406:Tenm3	UTSW	8	48228555	missense	probably damaging	1.00
R3724:Tenm3	UTSW	8	48277746	missense	probably damaging	0.97
R4009:Tenm3	UTSW	8	48349223	missense	probably damaging	1.00
R4210:Tenm3	UTSW	8	48349404	missense	probably damaging	1.00
R4293:Tenm3	UTSW	8	48395658	missense	probably damaging	1.00
R4656:Tenm3	UTSW	8	48293726	missense	probably damaging	1.00
R4663:Tenm3	UTSW	8	48235970	missense	probably damaging	1.00
R4835:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R4851:Tenm3	UTSW	8	48310621	critical splice donor site	probably null
R4867:Tenm3	UTSW	8	48235821	missense	probably damaging	1.00
R4892:Tenm3	UTSW	8	48276861	missense	probably damaging	0.99
R4895:Tenm3	UTSW	8	48300971	missense	probably damaging	1.00
R4962:Tenm3	UTSW	8	48278961	nonsense	probably null
R4995:Tenm3	UTSW	8	48229137	missense	possibly damaging	0.87
R4996:Tenm3	UTSW	8	48235826	missense	probably damaging	0.97
R5091:Tenm3	UTSW	8	48342308	missense	probably benign	0.14
R5228:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5253:Tenm3	UTSW	8	48229198	missense	possibly damaging	0.92
R5260:Tenm3	UTSW	8	48236855	missense	probably damaging	1.00
R5363:Tenm3	UTSW	8	48287831	missense	possibly damaging	0.55
R5414:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5427:Tenm3	UTSW	8	48236564	missense	probably damaging	1.00
R5431:Tenm3	UTSW	8	48367377	nonsense	probably null
R5566:Tenm3	UTSW	8	48279006	missense	probably damaging	1.00
R5579:Tenm3	UTSW	8	48236764	missense	probably damaging	1.00
R5656:Tenm3	UTSW	8	48228762	missense	probably damaging	1.00
R5931:Tenm3	UTSW	8	48646498	missense	probably benign	0.00
R5959:Tenm3	UTSW	8	48646447	nonsense	probably null
R5965:Tenm3	UTSW	8	48228508	nonsense	probably null
R6062:Tenm3	UTSW	8	48343406	missense	possibly damaging	0.46
R6151:Tenm3	UTSW	8	48395573	missense	probably damaging	1.00
R6157:Tenm3	UTSW	8	48298808	missense	probably damaging	0.96
R6167:Tenm3	UTSW	8	48254622	missense	possibly damaging	0.46
R6217:Tenm3	UTSW	8	48293665	missense	probably damaging	0.99
R6233:Tenm3	UTSW	8	48417059	missense	probably damaging	1.00
R6270:Tenm3	UTSW	8	48367394	missense	probably damaging	0.98
R6329:Tenm3	UTSW	8	48276849	missense	probably damaging	0.99
R6466:Tenm3	UTSW	8	48236063	missense	probably damaging	0.97
R6515:Tenm3	UTSW	8	48417222	missense	probably benign
R6516:Tenm3	UTSW	8	48417222	missense	probably benign
R6747:Tenm3	UTSW	8	48343243	missense	probably damaging	1.00
R6782:Tenm3	UTSW	8	48646256	critical splice donor site	probably null
R6788:Tenm3	UTSW	8	48674493	missense	probably damaging	1.00
R6823:Tenm3	UTSW	8	48256837	missense	probably damaging	0.99
R6846:Tenm3	UTSW	8	48276738	missense	probably benign	0.39
R6913:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R6941:Tenm3	UTSW	8	48674416	missense	probably damaging	0.99
R6950:Tenm3	UTSW	8	48240479	nonsense	probably null
R6968:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6970:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6993:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R7003:Tenm3	UTSW	8	48240444	missense	probably damaging	1.00
R7125:Tenm3	UTSW	8	48674553	missense	probably benign	0.00
R7140:Tenm3	UTSW	8	48292236	missense	probably damaging	1.00
R7222:Tenm3	UTSW	8	48300969	missense	probably damaging	1.00
R7232:Tenm3	UTSW	8	48235935	missense	probably damaging	1.00
R7336:Tenm3	UTSW	8	48236177	missense	possibly damaging	0.93
R7417:Tenm3	UTSW	8	48236183	missense	probably damaging	1.00
R7526:Tenm3	UTSW	8	48287812	missense	probably damaging	0.96
R7527:Tenm3	UTSW	8	48276600	missense	possibly damaging	0.60
R7616:Tenm3	UTSW	8	48341049	missense	possibly damaging	0.56
R7662:Tenm3	UTSW	8	48335727	missense	probably benign	0.27
R7734:Tenm3	UTSW	8	48646333	missense	probably damaging	1.00
R7802:Tenm3	UTSW	8	48236465	missense	probably damaging	1.00
R7812:Tenm3	UTSW	8	48276300	missense	probably benign	0.01
R7843:Tenm3	UTSW	8	48229111	nonsense	probably null
R7951:Tenm3	UTSW	8	48310703	missense	possibly damaging	0.86
R8293:Tenm3	UTSW	8	48367422	missense	possibly damaging	0.91
R8336:Tenm3	UTSW	8	48293773	missense	probably damaging	1.00
R8351:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8387:Tenm3	UTSW	8	48287848	missense	probably damaging	0.98
R8414:Tenm3	UTSW	8	48293509	missense	probably damaging	1.00
R8451:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8465:Tenm3	UTSW	8	48229181	missense	probably damaging	1.00
R8528:Tenm3	UTSW	8	48342633	missense	probably damaging	1.00
R8717:Tenm3	UTSW	8	48299645	missense	possibly damaging	0.77
R8734:Tenm3	UTSW	8	48349356	missense	probably benign	0.16
R8781:Tenm3	UTSW	8	48342449	frame shift	probably null
R8820:Tenm3	UTSW	8	48310724	missense	probably damaging	0.96
R8821:Tenm3	UTSW	8	48276382	missense
R8831:Tenm3	UTSW	8	48276382	missense
R8853:Tenm3	UTSW	8	48342347	missense	probably damaging	1.00
R8900:Tenm3	UTSW	8	48236402	missense	probably damaging	1.00
R8931:Tenm3	UTSW	8	48235602	missense	probably damaging	1.00
R8933:Tenm3	UTSW	8	48279060	missense	possibly damaging	0.53
R8989:Tenm3	UTSW	8	48235348	nonsense	probably null
R8998:Tenm3	UTSW	8	48276687	missense	probably damaging	1.00
R9008:Tenm3	UTSW	8	48342653	missense	probably damaging	0.98
R9017:Tenm3	UTSW	8	48254633	missense	probably damaging	0.99
R9101:Tenm3	UTSW	8	48292151	missense	probably damaging	1.00
R9108:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R9142:Tenm3	UTSW	8	48335513	missense	unknown
R9231:Tenm3	UTSW	8	48236196	missense	probably damaging	1.00
R9309:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R9310:Tenm3	UTSW	8	48555900	unclassified	probably benign
R9336:Tenm3	UTSW	8	48417080	missense	probably damaging	1.00
R9373:Tenm3	UTSW	8	48299655	missense	probably damaging	1.00
R9393:Tenm3	UTSW	8	48674524	missense	probably damaging	0.99
R9509:Tenm3	UTSW	8	48313257	nonsense	probably null
R9575:Tenm3	UTSW	8	48235761	missense	possibly damaging	0.94
R9698:Tenm3	UTSW	8	48236211	missense	probably damaging	1.00
R9722:Tenm3	UTSW	8	48300814	missense	probably benign	0.00
R9788:Tenm3	UTSW	8	48335561	missense	probably benign	0.02
X0010:Tenm3	UTSW	8	48287829	missense	probably damaging	0.98
X0025:Tenm3	UTSW	8	48236477	missense	probably damaging	1.00
Z1177:Tenm3	UTSW	8	48276780	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCACTCTTGCTTACGCTAGACAC -3'
(R):5'- AAGGCGCTATACAAACTCGTCCG -3'

Sequencing Primer
(F):5'- CTTACGCTAGACACCAGTGGAG -3'
(R):5'- CGCGGACAATGAGGAGTG -3'

Posted On

2013-06-11