Mutagenetix > Incidental Mutations

Incidental Mutation 'R0573:Otogl'

46539

Institutional Source

Beutler Lab

Gene Symbol

Otogl

Ensembl Gene

ENSMUSG00000091455

Gene Name

otogelin-like

Synonyms

Gm6924

MMRRC Submission

038763-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0573 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107760531-107912134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 107780988 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1809 (N1809K)

Ref Sequence

ENSEMBL: ENSMUSP00000129467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165341]

Predicted Effect

probably benign
Transcript: ENSMUST00000165341
AA Change: N1809K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: N1809K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	71	101	3.36e1	SMART
VWD	104	264	4.74e-29	SMART
C8	305	378	6.13e-6	SMART
VWD	463	625	7e-41	SMART
C8	668	733	3.6e-3	SMART
Pfam:TIL	736	791	2.3e-11	PFAM
SCOP:d1coua_	833	911	1e-6	SMART
VWD	928	1085	1.29e-30	SMART
C8	1120	1194	1.81e-26	SMART
Pfam:AbfB	1230	1350	1.2e-10	PFAM
Pfam:TIL	1364	1418	6.1e-8	PFAM
VWD	1497	1671	2.34e-10	SMART
C8	1705	1775	9.56e-17	SMART
Pfam:TIL	1778	1836	1.6e-8	PFAM
low complexity region	1870	1886	N/A	INTRINSIC
CT	2242	2325	6.9e-14	SMART

Meta Mutation Damage Score

0.1128

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.5%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	A	T	12: 113,491,658	K698N	possibly damaging	Het
Adcy8	A	T	15: 64,822,195	V411D	probably damaging	Het
Arfgef3	T	A	10: 18,599,288	E1550V	probably damaging	Het
Asb3	T	A	11: 31,061,406	I306K	probably damaging	Het
Asic4	T	A	1: 75,469,102		probably benign	Het
B020004J07Rik	A	C	4: 101,835,414	V463G	probably damaging	Het
Basp1	G	T	15: 25,364,862	D16E	unknown	Het
Cbll1	A	T	12: 31,490,540	I123N	probably damaging	Het
Ccdc141	A	T	2: 77,039,493	H889Q	probably benign	Het
Ccdc65	T	C	15: 98,721,049	V303A	probably benign	Het
Ceacam20	T	A	7: 19,986,668	M60K	probably damaging	Het
Chd9	T	A	8: 90,998,595	V711D	probably damaging	Het
Clcn1	T	A	6: 42,313,045		probably null	Het
Col16a1	A	T	4: 130,068,475		probably benign	Het
Col4a3	C	A	1: 82,716,363	P1568Q	possibly damaging	Het
Colec12	C	A	18: 9,858,650	P478T	probably damaging	Het
Dchs1	T	C	7: 105,758,778	H1949R	probably damaging	Het
Dgka	A	G	10: 128,737,007		probably null	Het
Dlgap4	A	G	2: 156,746,191	I669V	probably benign	Het
Dsg1c	T	A	18: 20,279,241	D543E	probably benign	Het
Egflam	A	T	15: 7,242,425	C677*	probably null	Het
Eml5	A	C	12: 98,824,772		probably null	Het
Fbn1	G	A	2: 125,389,249	R466C	probably damaging	Het
Fnbp1	C	A	2: 31,058,978	D198Y	probably damaging	Het
Gfra3	T	A	18: 34,691,615	M272L	probably benign	Het
Gm5422	T	A	10: 31,250,160		noncoding transcript	Het
Gpr21	T	A	2: 37,517,544	I34N	probably damaging	Het
Hspb2	G	T	9: 50,751,364	T155K	probably benign	Het
Il21r	A	G	7: 125,625,285	T24A	probably benign	Het
Mmadhc	T	A	2: 50,292,835	H43L	possibly damaging	Het
Morn1	T	A	4: 155,111,016	D278E	possibly damaging	Het
Myoc	T	C	1: 162,648,674	Y316H	probably damaging	Het
Nags	A	G	11: 102,146,979	D266G	probably damaging	Het
Nlrp4b	A	G	7: 10,714,215	N115S	probably benign	Het
Nlrp5	T	A	7: 23,417,631	I260N	probably damaging	Het
Obscn	G	A	11: 59,036,079	R6190C	probably damaging	Het
Olfr1105	A	G	2: 87,033,468	F251S	probably damaging	Het
Olfr1449	T	C	19: 12,935,260	V174A	possibly damaging	Het
Orc4	C	T	2: 48,917,273	M215I	probably benign	Het
Osbpl6	A	T	2: 76,590,391	H770L	probably damaging	Het
Pde3a	G	T	6: 141,492,231	V1009L	probably damaging	Het
Pign	T	C	1: 105,653,177	Y159C	probably damaging	Het
Pik3cg	C	A	12: 32,197,197	M842I	probably damaging	Het
Pnliprp1	C	T	19: 58,734,882	T235I	possibly damaging	Het
Prpf8	A	G	11: 75,490,654	N239D	probably damaging	Het
Psd2	T	A	18: 35,980,493		probably benign	Het
Ptprt	T	C	2: 161,551,748	D1251G	probably damaging	Het
Pwp2	G	A	10: 78,182,686	S88L	probably benign	Het
Rassf4	C	T	6: 116,647,555		probably benign	Het
Rexo1	A	G	10: 80,544,850	S884P	probably damaging	Het
Rgs20	C	A	1: 5,020,814	R131L	possibly damaging	Het
Setd4	A	G	16: 93,589,946	V288A	probably benign	Het
Stx3	G	T	19: 11,785,746	T160K	probably damaging	Het
Tas2r102	T	A	6: 132,762,673	S181R	probably damaging	Het
Tenm3	T	C	8: 48,674,399		probably benign	Het
Tmem33	T	C	5: 67,264,260		probably benign	Het
Trim33	A	G	3: 103,351,990		probably benign	Het
Trip11	A	G	12: 101,886,860	I491T	probably benign	Het
Trp53bp1	A	G	2: 121,228,172		probably benign	Het
Tuba4a	T	C	1: 75,216,373	D199G	probably benign	Het
Zcchc4	A	G	5: 52,795,979	Y110C	probably damaging	Het
Zp2	C	T	7: 120,135,470		probably benign	Het

Other mutations in Otogl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
H8562:Otogl	UTSW	10	107910956	missense	probably benign	0.00
R0084:Otogl	UTSW	10	107901341	missense	probably damaging	0.96
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0294:Otogl	UTSW	10	107777228	missense	probably damaging	1.00
R0360:Otogl	UTSW	10	107770650	splice site	probably benign
R0442:Otogl	UTSW	10	107876855	missense	probably damaging	1.00
R0488:Otogl	UTSW	10	107803605	missense	probably benign	0.02
R0507:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0581:Otogl	UTSW	10	107789040	missense	possibly damaging	0.79
R0613:Otogl	UTSW	10	107817070	missense	probably damaging	0.99
R0614:Otogl	UTSW	10	107798355	missense	probably benign	0.14
R0742:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0846:Otogl	UTSW	10	107772296	missense	probably benign	0.40
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1439:Otogl	UTSW	10	107779252	missense	probably benign	0.02
R1457:Otogl	UTSW	10	107878152	splice site	probably null
R1526:Otogl	UTSW	10	107869526	missense	probably damaging	1.00
R1662:Otogl	UTSW	10	107798357	missense	possibly damaging	0.84
R1664:Otogl	UTSW	10	107806576	missense	probably benign	0.00
R1667:Otogl	UTSW	10	107813965	nonsense	probably null
R1695:Otogl	UTSW	10	107814017	missense	probably damaging	0.99
R1731:Otogl	UTSW	10	107817111	missense	probably damaging	1.00
R1733:Otogl	UTSW	10	107783712	missense	possibly damaging	0.46
R1764:Otogl	UTSW	10	107899461	nonsense	probably null
R1824:Otogl	UTSW	10	107779831	missense	probably benign
R1850:Otogl	UTSW	10	107878064	missense	probably damaging	1.00
R1856:Otogl	UTSW	10	107854264	missense	possibly damaging	0.92
R1875:Otogl	UTSW	10	107899590	missense	probably damaging	1.00
R1938:Otogl	UTSW	10	107777575	missense	probably damaging	0.98
R1986:Otogl	UTSW	10	107794190	critical splice acceptor site	probably null
R2072:Otogl	UTSW	10	107781043	missense	probably damaging	1.00
R2117:Otogl	UTSW	10	107858918	missense	probably benign	0.06
R2219:Otogl	UTSW	10	107856977	missense	probably damaging	1.00
R2508:Otogl	UTSW	10	107874500	missense	probably damaging	0.99
R2883:Otogl	UTSW	10	107768981	missense	probably damaging	1.00
R2931:Otogl	UTSW	10	107820004	missense	possibly damaging	0.85
R3620:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3621:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3735:Otogl	UTSW	10	107899529	nonsense	probably null
R3812:Otogl	UTSW	10	107899471	missense	probably damaging	1.00
R3880:Otogl	UTSW	10	107827704	missense	probably damaging	0.96
R3958:Otogl	UTSW	10	107821925	missense	probably damaging	1.00
R4063:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4064:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4108:Otogl	UTSW	10	107771244	missense	probably benign	0.01
R4352:Otogl	UTSW	10	107869535	missense	probably damaging	1.00
R4526:Otogl	UTSW	10	107886980	missense	probably damaging	1.00
R4614:Otogl	UTSW	10	107892124	nonsense	probably null
R4703:Otogl	UTSW	10	107821924	missense	probably damaging	1.00
R4741:Otogl	UTSW	10	107779260	missense	probably benign	0.00
R4790:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R4801:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4802:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4910:Otogl	UTSW	10	107879517	missense	probably benign	0.05
R4913:Otogl	UTSW	10	107876855	missense	probably damaging	0.98
R5238:Otogl	UTSW	10	107768973	missense	probably damaging	1.00
R5261:Otogl	UTSW	10	107777592	missense	probably benign	0.16
R5387:Otogl	UTSW	10	107780933	missense	probably benign	0.03
R5395:Otogl	UTSW	10	107817138	missense	probably benign	0.39
R5403:Otogl	UTSW	10	107808756	missense	probably benign	0.08
R5482:Otogl	UTSW	10	107821941	missense	probably damaging	0.99
R5547:Otogl	UTSW	10	107782048	missense	possibly damaging	0.55
R5611:Otogl	UTSW	10	107786769	missense	probably damaging	1.00
R5642:Otogl	UTSW	10	107886552	missense	probably benign	0.44
R5690:Otogl	UTSW	10	107777117	synonymous	silent
R5711:Otogl	UTSW	10	107777117	synonymous	silent
R5731:Otogl	UTSW	10	107881464	missense	probably damaging	0.98
R5743:Otogl	UTSW	10	107857001	missense	possibly damaging	0.67
R5782:Otogl	UTSW	10	107777117	synonymous	silent
R5820:Otogl	UTSW	10	107777117	synonymous	silent
R5897:Otogl	UTSW	10	107777117	synonymous	silent
R6004:Otogl	UTSW	10	107879529	missense	probably damaging	1.00
R6145:Otogl	UTSW	10	107777117	synonymous	silent
R6146:Otogl	UTSW	10	107777117	synonymous	silent
R6147:Otogl	UTSW	10	107777117	synonymous	silent
R6149:Otogl	UTSW	10	107881453	missense	probably benign	0.36
R6226:Otogl	UTSW	10	107771206	nonsense	probably null
R6283:Otogl	UTSW	10	107790500	missense	probably damaging	0.98
R6414:Otogl	UTSW	10	107782050	missense	probably damaging	1.00
R6604:Otogl	UTSW	10	107822034	splice site	probably null
R6634:Otogl	UTSW	10	107862304	missense	probably damaging	1.00
R6727:Otogl	UTSW	10	107777117	synonymous	silent
R6755:Otogl	UTSW	10	107853303	nonsense	probably null
R6795:Otogl	UTSW	10	107777117	synonymous	silent
R6797:Otogl	UTSW	10	107777117	synonymous	silent
R6864:Otogl	UTSW	10	107827806	missense	probably damaging	0.96
R6924:Otogl	UTSW	10	107808641	missense	probably damaging	1.00
R6967:Otogl	UTSW	10	107814050	missense	probably benign	0.01
R7000:Otogl	UTSW	10	107779831	missense	probably benign
R7075:Otogl	UTSW	10	107778929	missense	probably benign	0.16
R7122:Otogl	UTSW	10	107866654	missense	probably benign	0.08
R7176:Otogl	UTSW	10	107778911	missense	probably damaging	1.00
R7184:Otogl	UTSW	10	107763200	missense	probably damaging	1.00
R7199:Otogl	UTSW	10	107874533	missense	possibly damaging	0.88
R7252:Otogl	UTSW	10	107821943	missense	probably benign	0.06
R7286:Otogl	UTSW	10	107770610	missense	probably benign	0.00
R7373:Otogl	UTSW	10	107901251	missense	probably damaging	1.00
R7449:Otogl	UTSW	10	107803663	missense	probably damaging	1.00
R7486:Otogl	UTSW	10	107821988	missense	probably damaging	1.00
R7493:Otogl	UTSW	10	107886982	missense	probably benign	0.06
R7659:Otogl	UTSW	10	107777120	missense	probably benign	0.19
R7732:Otogl	UTSW	10	107806664	missense	probably benign	0.01
R7754:Otogl	UTSW	10	107869546	missense	probably damaging	0.99
R7757:Otogl	UTSW	10	107876921	missense	probably damaging	1.00
R7800:Otogl	UTSW	10	107886515	missense	probably damaging	0.99
R7864:Otogl	UTSW	10	107869567	missense	probably damaging	1.00
R7879:Otogl	UTSW	10	107777109	missense	probably benign	0.00
R7941:Otogl	UTSW	10	107806802	splice site	probably null
R7956:Otogl	UTSW	10	107878026	missense	possibly damaging	0.62
R7988:Otogl	UTSW	10	107895776	missense	probably damaging	1.00
R8057:Otogl	UTSW	10	107808615	missense	probably benign	0.00
R8058:Otogl	UTSW	10	107762426	missense	probably damaging	1.00
R8127:Otogl	UTSW	10	107895752	missense	probably damaging	1.00
R8143:Otogl	UTSW	10	107806666	missense	probably damaging	1.00
R8310:Otogl	UTSW	10	107777600	missense	possibly damaging	0.94
R8319:Otogl	UTSW	10	107853266	critical splice donor site	probably null
R8339:Otogl	UTSW	10	107789535	missense	probably damaging	0.99
R8339:Otogl	UTSW	10	107789536	missense	probably benign	0.34
R8394:Otogl	UTSW	10	107886465	critical splice donor site	probably null
R8428:Otogl	UTSW	10	107798736	missense	probably damaging	1.00
R8444:Otogl	UTSW	10	107857114	missense	probably benign	0.01
R8501:Otogl	UTSW	10	107790560	missense	probably benign
R8503:Otogl	UTSW	10	107892126	missense	probably damaging	1.00
X0065:Otogl	UTSW	10	107895782	missense	probably damaging	1.00
X0067:Otogl	UTSW	10	107866677	missense	probably damaging	1.00
Z1176:Otogl	UTSW	10	107777213	missense	probably benign
Z1176:Otogl	UTSW	10	107778873	missense	probably damaging	0.97
Z1176:Otogl	UTSW	10	107789032	missense	probably benign	0.00
Z1177:Otogl	UTSW	10	107763258	nonsense	probably null
Z1177:Otogl	UTSW	10	107853397	missense	possibly damaging	0.78
Z1177:Otogl	UTSW	10	107876903	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TTTCTTCCAATGCCTGAGTCATCTTTGA -3'
(R):5'- TGTCCCTTGGTTGTATGGAACAGAAAC -3'

Sequencing Primer
(F):5'- CCTGAGTCATCTTTGATTAATTTCAC -3'
(R):5'- GGAATATCAGCCCTGTGTGA -3'

Posted On

2013-06-11