Mutagenetix > Incidental Mutations

Incidental Mutation 'R0573:Trip11'

46548

Institutional Source

Beutler Lab

Gene Symbol

Trip11

Ensembl Gene

ENSMUSG00000021188

Gene Name

thyroid hormone receptor interactor 11

Synonyms

GMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230

MMRRC Submission

038763-MU

Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0573 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101834043-101913267 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101886860 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 491 (I491T)

Ref Sequence

ENSEMBL: ENSMUSP00000135669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]

Predicted Effect

probably benign
Transcript: ENSMUST00000021605
AA Change: I492T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: I492T

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	54	130	N/A	INTRINSIC
coiled coil region	167	194	N/A	INTRINSIC
coiled coil region	218	702	N/A	INTRINSIC
coiled coil region	754	990	N/A	INTRINSIC
coiled coil region	1022	1051	N/A	INTRINSIC
coiled coil region	1196	1261	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
coiled coil region	1336	1481	N/A	INTRINSIC
coiled coil region	1547	1657	N/A	INTRINSIC
coiled coil region	1681	1771	N/A	INTRINSIC
low complexity region	1934	1945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176728

SMART Domains

Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
Pfam:Orthopox_A5L	48	282	6.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177183
AA Change: I207T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: I207T

Domain	Start	End	E-Value	Type
coiled coil region	33	158	N/A	INTRINSIC
coiled coil region	179	417	N/A	INTRINSIC
coiled coil region	469	705	N/A	INTRINSIC
coiled coil region	737	766	N/A	INTRINSIC
coiled coil region	911	976	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
coiled coil region	1051	1196	N/A	INTRINSIC
coiled coil region	1262	1372	N/A	INTRINSIC
coiled coil region	1396	1486	N/A	INTRINSIC
low complexity region	1649	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177480

Predicted Effect

probably benign
Transcript: ENSMUST00000177536
AA Change: I491T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188
AA Change: I491T

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	53	129	N/A	INTRINSIC
coiled coil region	166	193	N/A	INTRINSIC
coiled coil region	217	517	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.5%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	A	T	12: 113,491,658	K698N	possibly damaging	Het
Adcy8	A	T	15: 64,822,195	V411D	probably damaging	Het
Arfgef3	T	A	10: 18,599,288	E1550V	probably damaging	Het
Asb3	T	A	11: 31,061,406	I306K	probably damaging	Het
Asic4	T	A	1: 75,469,102		probably benign	Het
B020004J07Rik	A	C	4: 101,835,414	V463G	probably damaging	Het
Basp1	G	T	15: 25,364,862	D16E	unknown	Het
Cbll1	A	T	12: 31,490,540	I123N	probably damaging	Het
Ccdc141	A	T	2: 77,039,493	H889Q	probably benign	Het
Ccdc65	T	C	15: 98,721,049	V303A	probably benign	Het
Ceacam20	T	A	7: 19,986,668	M60K	probably damaging	Het
Chd9	T	A	8: 90,998,595	V711D	probably damaging	Het
Clcn1	T	A	6: 42,313,045		probably null	Het
Col16a1	A	T	4: 130,068,475		probably benign	Het
Col4a3	C	A	1: 82,716,363	P1568Q	possibly damaging	Het
Colec12	C	A	18: 9,858,650	P478T	probably damaging	Het
Dchs1	T	C	7: 105,758,778	H1949R	probably damaging	Het
Dgka	A	G	10: 128,737,007		probably null	Het
Dlgap4	A	G	2: 156,746,191	I669V	probably benign	Het
Dsg1c	T	A	18: 20,279,241	D543E	probably benign	Het
Egflam	A	T	15: 7,242,425	C677*	probably null	Het
Eml5	A	C	12: 98,824,772		probably null	Het
Fbn1	G	A	2: 125,389,249	R466C	probably damaging	Het
Fnbp1	C	A	2: 31,058,978	D198Y	probably damaging	Het
Gfra3	T	A	18: 34,691,615	M272L	probably benign	Het
Gm5422	T	A	10: 31,250,160		noncoding transcript	Het
Gpr21	T	A	2: 37,517,544	I34N	probably damaging	Het
Hspb2	G	T	9: 50,751,364	T155K	probably benign	Het
Il21r	A	G	7: 125,625,285	T24A	probably benign	Het
Mmadhc	T	A	2: 50,292,835	H43L	possibly damaging	Het
Morn1	T	A	4: 155,111,016	D278E	possibly damaging	Het
Myoc	T	C	1: 162,648,674	Y316H	probably damaging	Het
Nags	A	G	11: 102,146,979	D266G	probably damaging	Het
Nlrp4b	A	G	7: 10,714,215	N115S	probably benign	Het
Nlrp5	T	A	7: 23,417,631	I260N	probably damaging	Het
Obscn	G	A	11: 59,036,079	R6190C	probably damaging	Het
Olfr1105	A	G	2: 87,033,468	F251S	probably damaging	Het
Olfr1449	T	C	19: 12,935,260	V174A	possibly damaging	Het
Orc4	C	T	2: 48,917,273	M215I	probably benign	Het
Osbpl6	A	T	2: 76,590,391	H770L	probably damaging	Het
Otogl	A	C	10: 107,780,988	N1809K	probably benign	Het
Pde3a	G	T	6: 141,492,231	V1009L	probably damaging	Het
Pign	T	C	1: 105,653,177	Y159C	probably damaging	Het
Pik3cg	C	A	12: 32,197,197	M842I	probably damaging	Het
Pnliprp1	C	T	19: 58,734,882	T235I	possibly damaging	Het
Prpf8	A	G	11: 75,490,654	N239D	probably damaging	Het
Psd2	T	A	18: 35,980,493		probably benign	Het
Ptprt	T	C	2: 161,551,748	D1251G	probably damaging	Het
Pwp2	G	A	10: 78,182,686	S88L	probably benign	Het
Rassf4	C	T	6: 116,647,555		probably benign	Het
Rexo1	A	G	10: 80,544,850	S884P	probably damaging	Het
Rgs20	C	A	1: 5,020,814	R131L	possibly damaging	Het
Setd4	A	G	16: 93,589,946	V288A	probably benign	Het
Stx3	G	T	19: 11,785,746	T160K	probably damaging	Het
Tas2r102	T	A	6: 132,762,673	S181R	probably damaging	Het
Tenm3	T	C	8: 48,674,399		probably benign	Het
Tmem33	T	C	5: 67,264,260		probably benign	Het
Trim33	A	G	3: 103,351,990		probably benign	Het
Trp53bp1	A	G	2: 121,228,172		probably benign	Het
Tuba4a	T	C	1: 75,216,373	D199G	probably benign	Het
Zcchc4	A	G	5: 52,795,979	Y110C	probably damaging	Het
Zp2	C	T	7: 120,135,470		probably benign	Het

Other mutations in Trip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Trip11	APN	12	101886147	missense	probably benign	0.37
IGL00484:Trip11	APN	12	101885311	nonsense	probably null
IGL00972:Trip11	APN	12	101894337	missense	probably null	1.00
IGL01476:Trip11	APN	12	101898911	missense	probably damaging	0.96
IGL01591:Trip11	APN	12	101883345	missense	probably damaging	0.98
IGL01667:Trip11	APN	12	101878862	missense	probably damaging	1.00
IGL01764:Trip11	APN	12	101884631	missense	probably damaging	1.00
IGL01789:Trip11	APN	12	101871831	missense	probably benign	0.05
IGL01814:Trip11	APN	12	101884488	missense	probably damaging	0.98
IGL01898:Trip11	APN	12	101885676	missense	probably benign
IGL01924:Trip11	APN	12	101886884	missense	possibly damaging	0.93
IGL02020:Trip11	APN	12	101884313	missense	probably damaging	1.00
IGL02475:Trip11	APN	12	101895683	missense	probably benign	0.01
IGL02544:Trip11	APN	12	101893521	missense	probably damaging	1.00
IGL02678:Trip11	APN	12	101883390	missense	probably damaging	0.96
IGL02714:Trip11	APN	12	101884001	missense	probably damaging	1.00
IGL02718:Trip11	APN	12	101886025	missense	probably benign	0.24
IGL02904:Trip11	APN	12	101886838	missense	probably damaging	1.00
IGL03012:Trip11	APN	12	101883936	missense	probably damaging	1.00
IGL03191:Trip11	APN	12	101898925	missense	probably damaging	1.00
IGL03327:Trip11	APN	12	101883418	missense	possibly damaging	0.87
IGL03337:Trip11	APN	12	101885019	missense	probably damaging	1.00
NA:Trip11	UTSW	12	101894321	unclassified	probably null
R0027:Trip11	UTSW	12	101885169	missense	probably benign	0.00
R0028:Trip11	UTSW	12	101884757	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0505:Trip11	UTSW	12	101885672	missense	probably damaging	0.98
R0556:Trip11	UTSW	12	101884518	nonsense	probably null
R0626:Trip11	UTSW	12	101885976	missense	possibly damaging	0.54
R1519:Trip11	UTSW	12	101886160	missense	probably benign	0.04
R1530:Trip11	UTSW	12	101912767	missense	unknown
R1647:Trip11	UTSW	12	101884392	nonsense	probably null
R1648:Trip11	UTSW	12	101884392	nonsense	probably null
R1856:Trip11	UTSW	12	101883333	nonsense	probably null
R2013:Trip11	UTSW	12	101837722	missense	probably damaging	1.00
R2017:Trip11	UTSW	12	101885360	missense	probably benign	0.00
R2206:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2207:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2304:Trip11	UTSW	12	101898977	missense	possibly damaging	0.58
R2328:Trip11	UTSW	12	101878827	makesense	probably null
R2513:Trip11	UTSW	12	101837727	missense	possibly damaging	0.94
R3499:Trip11	UTSW	12	101893694	missense	possibly damaging	0.87
R4105:Trip11	UTSW	12	101894322	nonsense	probably null
R4124:Trip11	UTSW	12	101895698	nonsense	probably null
R4126:Trip11	UTSW	12	101895698	nonsense	probably null
R4128:Trip11	UTSW	12	101895698	nonsense	probably null
R4175:Trip11	UTSW	12	101895698	nonsense	probably null
R4176:Trip11	UTSW	12	101895698	nonsense	probably null
R4181:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4296:Trip11	UTSW	12	101885868	nonsense	probably null
R4302:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4306:Trip11	UTSW	12	101886939	missense	probably benign
R4342:Trip11	UTSW	12	101884316	missense	probably damaging	1.00
R4576:Trip11	UTSW	12	101886240	nonsense	probably null
R4586:Trip11	UTSW	12	101883341	missense	possibly damaging	0.55
R4634:Trip11	UTSW	12	101837616	missense	probably damaging	1.00
R4696:Trip11	UTSW	12	101885290	missense	possibly damaging	0.71
R4792:Trip11	UTSW	12	101885446	missense	probably benign	0.10
R4903:Trip11	UTSW	12	101886806	critical splice donor site	probably null
R5001:Trip11	UTSW	12	101884910	nonsense	probably null
R5017:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R5227:Trip11	UTSW	12	101884920	missense	probably damaging	1.00
R5231:Trip11	UTSW	12	101885601	missense	probably damaging	0.96
R5539:Trip11	UTSW	12	101885127	missense	probably damaging	0.98
R5754:Trip11	UTSW	12	101885665	nonsense	probably null
R5755:Trip11	UTSW	12	101885665	nonsense	probably null
R5890:Trip11	UTSW	12	101885972	missense	probably damaging	0.99
R5910:Trip11	UTSW	12	101883479	missense	probably damaging	1.00
R6083:Trip11	UTSW	12	101889742	missense	probably benign	0.00
R6208:Trip11	UTSW	12	101898895	missense	probably damaging	1.00
R6216:Trip11	UTSW	12	101890600	missense	probably benign	0.31
R6315:Trip11	UTSW	12	101885578	missense	possibly damaging	0.84
R6413:Trip11	UTSW	12	101885531	missense	probably benign	0.12
R6590:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6690:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6914:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R6938:Trip11	UTSW	12	101837627	missense	probably damaging	0.98
R7015:Trip11	UTSW	12	101893683	missense	probably damaging	1.00
R7023:Trip11	UTSW	12	101885867	missense	probably benign	0.13
R7133:Trip11	UTSW	12	101884070	missense	probably damaging	0.97
R7271:Trip11	UTSW	12	101884352	missense	probably damaging	1.00
R7424:Trip11	UTSW	12	101885198	missense	probably damaging	1.00
R7431:Trip11	UTSW	12	101884019	missense	possibly damaging	0.84
R7472:Trip11	UTSW	12	101885380	missense	probably benign	0.00
R7491:Trip11	UTSW	12	101885435	missense	probably damaging	1.00
R7752:Trip11	UTSW	12	101886974	missense	probably benign	0.01
R7763:Trip11	UTSW	12	101844855	missense	probably benign	0.03
R7779:Trip11	UTSW	12	101883537	missense	probably damaging	0.97
R7844:Trip11	UTSW	12	101878144	missense	probably damaging	1.00
R7927:Trip11	UTSW	12	101878144	missense	probably damaging	1.00
R8055:Trip11	UTSW	12	101837665	missense	probably damaging	1.00
X0020:Trip11	UTSW	12	101885913	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTGTGCTAACTTGTTCACATCCC -3'
(R):5'- GCAAAACTACATGACCGGAGGCTG -3'

Sequencing Primer
(F):5'- TCAGAGCTGAAGAGCTTCAAATC -3'
(R):5'- TGGCATGGTTCCAGTACAAAG -3'

Posted On

2013-06-11