Incidental Mutation 'R0573:Stx3'
ID46559
Institutional Source Beutler Lab
Gene Symbol Stx3
Ensembl Gene ENSMUSG00000041488
Gene Namesyntaxin 3
SynonymsSyn-3, syntaxin 3B, syntaxin 3A
MMRRC Submission 038763-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0573 (G1)
Quality Score224
Status Validated
Chromosome19
Chromosomal Location11775118-11819403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 11785746 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 160 (T160K)
Ref Sequence ENSEMBL: ENSMUSP00000147461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047698] [ENSMUST00000069285] [ENSMUST00000075304] [ENSMUST00000211047] [ENSMUST00000211641]
Predicted Effect probably benign
Transcript: ENSMUST00000047698
SMART Domains Protein: ENSMUSP00000037317
Gene: ENSMUSG00000041488

DomainStartEndE-ValueType
SynN 27 146 5.39e-41 SMART
t_SNARE 186 253 1.07e-19 SMART
transmembrane domain 265 286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069285
AA Change: T160K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069529
Gene: ENSMUSG00000041488
AA Change: T160K

DomainStartEndE-ValueType
SynN 27 146 5.39e-41 SMART
t_SNARE 186 253 6.87e-18 SMART
transmembrane domain 264 286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075304
AA Change: T160K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074776
Gene: ENSMUSG00000041488
AA Change: T160K

DomainStartEndE-ValueType
SynN 27 128 1.13e-16 SMART
t_SNARE 168 235 1.07e-19 SMART
transmembrane domain 247 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210481
Predicted Effect probably damaging
Transcript: ENSMUST00000211047
AA Change: T160K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211089
Predicted Effect probably damaging
Transcript: ENSMUST00000211641
AA Change: T142K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2605 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the syntaxin family. The encoded protein is targeted to the apical membrane of epithelial cells where it forms clusters and is important in establishing and maintaining polarity necessary for protein trafficking involving vesicle fusion and exocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,491,658 K698N possibly damaging Het
Adcy8 A T 15: 64,822,195 V411D probably damaging Het
Arfgef3 T A 10: 18,599,288 E1550V probably damaging Het
Asb3 T A 11: 31,061,406 I306K probably damaging Het
Asic4 T A 1: 75,469,102 probably benign Het
B020004J07Rik A C 4: 101,835,414 V463G probably damaging Het
Basp1 G T 15: 25,364,862 D16E unknown Het
Cbll1 A T 12: 31,490,540 I123N probably damaging Het
Ccdc141 A T 2: 77,039,493 H889Q probably benign Het
Ccdc65 T C 15: 98,721,049 V303A probably benign Het
Ceacam20 T A 7: 19,986,668 M60K probably damaging Het
Chd9 T A 8: 90,998,595 V711D probably damaging Het
Clcn1 T A 6: 42,313,045 probably null Het
Col16a1 A T 4: 130,068,475 probably benign Het
Col4a3 C A 1: 82,716,363 P1568Q possibly damaging Het
Colec12 C A 18: 9,858,650 P478T probably damaging Het
Dchs1 T C 7: 105,758,778 H1949R probably damaging Het
Dgka A G 10: 128,737,007 probably null Het
Dlgap4 A G 2: 156,746,191 I669V probably benign Het
Dsg1c T A 18: 20,279,241 D543E probably benign Het
Egflam A T 15: 7,242,425 C677* probably null Het
Eml5 A C 12: 98,824,772 probably null Het
Fbn1 G A 2: 125,389,249 R466C probably damaging Het
Fnbp1 C A 2: 31,058,978 D198Y probably damaging Het
Gfra3 T A 18: 34,691,615 M272L probably benign Het
Gm5422 T A 10: 31,250,160 noncoding transcript Het
Gpr21 T A 2: 37,517,544 I34N probably damaging Het
Hspb2 G T 9: 50,751,364 T155K probably benign Het
Il21r A G 7: 125,625,285 T24A probably benign Het
Mmadhc T A 2: 50,292,835 H43L possibly damaging Het
Morn1 T A 4: 155,111,016 D278E possibly damaging Het
Myoc T C 1: 162,648,674 Y316H probably damaging Het
Nags A G 11: 102,146,979 D266G probably damaging Het
Nlrp4b A G 7: 10,714,215 N115S probably benign Het
Nlrp5 T A 7: 23,417,631 I260N probably damaging Het
Obscn G A 11: 59,036,079 R6190C probably damaging Het
Olfr1105 A G 2: 87,033,468 F251S probably damaging Het
Olfr1449 T C 19: 12,935,260 V174A possibly damaging Het
Orc4 C T 2: 48,917,273 M215I probably benign Het
Osbpl6 A T 2: 76,590,391 H770L probably damaging Het
Otogl A C 10: 107,780,988 N1809K probably benign Het
Pde3a G T 6: 141,492,231 V1009L probably damaging Het
Pign T C 1: 105,653,177 Y159C probably damaging Het
Pik3cg C A 12: 32,197,197 M842I probably damaging Het
Pnliprp1 C T 19: 58,734,882 T235I possibly damaging Het
Prpf8 A G 11: 75,490,654 N239D probably damaging Het
Psd2 T A 18: 35,980,493 probably benign Het
Ptprt T C 2: 161,551,748 D1251G probably damaging Het
Pwp2 G A 10: 78,182,686 S88L probably benign Het
Rassf4 C T 6: 116,647,555 probably benign Het
Rexo1 A G 10: 80,544,850 S884P probably damaging Het
Rgs20 C A 1: 5,020,814 R131L possibly damaging Het
Setd4 A G 16: 93,589,946 V288A probably benign Het
Tas2r102 T A 6: 132,762,673 S181R probably damaging Het
Tenm3 T C 8: 48,674,399 probably benign Het
Tmem33 T C 5: 67,264,260 probably benign Het
Trim33 A G 3: 103,351,990 probably benign Het
Trip11 A G 12: 101,886,860 I491T probably benign Het
Trp53bp1 A G 2: 121,228,172 probably benign Het
Tuba4a T C 1: 75,216,373 D199G probably benign Het
Zcchc4 A G 5: 52,795,979 Y110C probably damaging Het
Zp2 C T 7: 120,135,470 probably benign Het
Other mutations in Stx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Stx3 APN 19 11791788 missense probably damaging 0.99
IGL01578:Stx3 APN 19 11786605 missense probably damaging 1.00
IGL02086:Stx3 APN 19 11818682 splice site probably benign
IGL02487:Stx3 APN 19 11783105 missense probably damaging 0.96
R0124:Stx3 UTSW 19 11791799 missense possibly damaging 0.83
R1739:Stx3 UTSW 19 11785523 missense probably damaging 1.00
R2869:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R2869:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R2870:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R2870:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R2874:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R4864:Stx3 UTSW 19 11777151 missense possibly damaging 0.79
R6156:Stx3 UTSW 19 11803510 missense probably damaging 1.00
R7298:Stx3 UTSW 19 11790048 nonsense probably null
R7443:Stx3 UTSW 19 11791844 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCAGAGTCCACAGAAGTTCCCTCC -3'
(R):5'- TCGAAGTGGCAAGTTGTCCAGAG -3'

Sequencing Primer
(F):5'- AGAAGTTCCCTCCCCTGC -3'
(R):5'- ACTGGAGTCAGGAGGTTGT -3'
Posted On2013-06-11