Incidental Mutation 'R0574:Olfr421-ps1'
ID46563
Institutional Source Beutler Lab
Gene Symbol Olfr421-ps1
Ensembl Gene ENSMUSG00000091950
Gene Nameolfactory receptor 421, pseudogene 1
SynonymsGA_x6K02T2P20D-21006310-21006124, Olfr421, Olfr422-ps1, MOR105-3, GA_x6K02T2P20D-21002372-21001425
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0574 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174151481-174152530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174151566 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 17 (F17L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179386] [ENSMUST00000213748]
Predicted Effect probably benign
Transcript: ENSMUST00000171570
AA Change: F17L

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129926
Gene: ENSMUSG00000091950
AA Change: F17L

DomainStartEndE-ValueType
Pfam:7tm_4 31 266 1.4e-52 PFAM
Pfam:7tm_1 41 264 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179386
AA Change: F17L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000136689
Gene: ENSMUSG00000091950
AA Change: F17L

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:7tm_1 41 288 5.6e-29 PFAM
Pfam:7tm_4 139 285 4.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213748
Meta Mutation Damage Score 0.2935 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Olfr421-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Olfr421-ps1 APN 1 174151536 missense probably benign 0.06
IGL03000:Olfr421-ps1 APN 1 174151560 missense probably benign 0.00
R0529:Olfr421-ps1 UTSW 1 174152130 missense probably benign 0.01
R1339:Olfr421-ps1 UTSW 1 174152211 missense probably damaging 1.00
R1658:Olfr421-ps1 UTSW 1 174152223 missense probably damaging 1.00
R1822:Olfr421-ps1 UTSW 1 174152214 missense probably benign 0.20
R1991:Olfr421-ps1 UTSW 1 174152121 missense probably damaging 1.00
R2391:Olfr421-ps1 UTSW 1 174152098 missense probably benign 0.10
R4299:Olfr421-ps1 UTSW 1 174152312 nonsense probably null
R4688:Olfr421-ps1 UTSW 1 174151596 missense possibly damaging 0.81
R5241:Olfr421-ps1 UTSW 1 174152101 missense probably benign 0.02
R5421:Olfr421-ps1 UTSW 1 174152295 nonsense probably null
Predicted Primers PCR Primer
(F):5'- cctgaaatcaggtcctcaGCCATC -3'
(R):5'- ACATCTGCAAGAGGCAGCCAATG -3'

Sequencing Primer
(F):5'- gtcctcaGCCATCTGTTGTG -3'
(R):5'- GAAGGAAATGGTCTTTTGCTCAC -3'
Posted On2013-06-11