Incidental Mutation 'R0574:Actrt3'
ID46565
Institutional Source Beutler Lab
Gene Symbol Actrt3
Ensembl Gene ENSMUSG00000037737
Gene Nameactin related protein T3
Synonyms
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0574 (G1)
Quality Score199
Status Validated
Chromosome3
Chromosomal Location30597073-30599939 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30599680 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 57 (E57G)
Ref Sequence ENSEMBL: ENSMUSP00000048360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047502] [ENSMUST00000047630] [ENSMUST00000192715] [ENSMUST00000195396] [ENSMUST00000195751]
Predicted Effect probably benign
Transcript: ENSMUST00000047502
SMART Domains Protein: ENSMUSP00000041034
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047630
AA Change: E57G

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048360
Gene: ENSMUSG00000037737
AA Change: E57G

DomainStartEndE-ValueType
ACTIN 5 369 3.33e-147 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083427
Predicted Effect probably benign
Transcript: ENSMUST00000192715
SMART Domains Protein: ENSMUSP00000141951
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194587
Predicted Effect probably benign
Transcript: ENSMUST00000195396
SMART Domains Protein: ENSMUSP00000141623
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195751
SMART Domains Protein: ENSMUSP00000141450
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Actrt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Actrt3 APN 3 30598039 missense probably damaging 0.99
IGL01783:Actrt3 APN 3 30598475 missense probably benign 0.33
IGL02684:Actrt3 APN 3 30599691 missense probably benign 0.15
R0017:Actrt3 UTSW 3 30598273 missense probably benign 0.00
R0410:Actrt3 UTSW 3 30598124 missense probably benign
R1710:Actrt3 UTSW 3 30599752 missense probably damaging 1.00
R1907:Actrt3 UTSW 3 30598567 missense probably damaging 1.00
R2338:Actrt3 UTSW 3 30597836 makesense probably null
R2870:Actrt3 UTSW 3 30599698 missense probably damaging 1.00
R2870:Actrt3 UTSW 3 30599698 missense probably damaging 1.00
R4913:Actrt3 UTSW 3 30598439 missense probably benign
R5683:Actrt3 UTSW 3 30598278 missense probably benign
R5719:Actrt3 UTSW 3 30598127 missense probably benign 0.40
R5942:Actrt3 UTSW 3 30598664 missense possibly damaging 0.50
R6153:Actrt3 UTSW 3 30599750 missense probably damaging 1.00
R6177:Actrt3 UTSW 3 30598167 nonsense probably null
R6741:Actrt3 UTSW 3 30598514 missense possibly damaging 0.85
R7584:Actrt3 UTSW 3 30598207 missense probably benign 0.06
R7603:Actrt3 UTSW 3 30598547 missense probably benign
R8166:Actrt3 UTSW 3 30598525 missense probably damaging 1.00
R8381:Actrt3 UTSW 3 30597836 makesense probably null
Z1177:Actrt3 UTSW 3 30598003 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCATGAACGGCCACTGTATGCTTG -3'
(R):5'- CCTCTGTGACGCGACATTACCAAC -3'

Sequencing Primer
(F):5'- gtttttTGTAAGGAGTGGCCTTG -3'
(R):5'- TGTCACCGCACAGCCTG -3'
Posted On2013-06-11