Incidental Mutation 'R0574:Mynn'
ID46566
Institutional Source Beutler Lab
Gene Symbol Mynn
Ensembl Gene ENSMUSG00000037730
Gene Namemyoneurin
SynonymsSBBIZ1, 2810011C24Rik
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R0574 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location30602065-30619873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30616739 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 587 (S587P)
Ref Sequence ENSEMBL: ENSMUSP00000141951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047502] [ENSMUST00000192715] [ENSMUST00000195396] [ENSMUST00000195751]
Predicted Effect probably benign
Transcript: ENSMUST00000047502
AA Change: S559P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000041034
Gene: ENSMUSG00000037730
AA Change: S559P

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192715
AA Change: S587P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141951
Gene: ENSMUSG00000037730
AA Change: S587P

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193736
Predicted Effect probably benign
Transcript: ENSMUST00000195396
SMART Domains Protein: ENSMUSP00000141623
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195751
SMART Domains Protein: ENSMUSP00000141450
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Meta Mutation Damage Score 0.0733 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BTB/POZ and zinc finger domain-containing protein family that are involved in the control of gene expression. Alternative splicing results in multiple transcript variants and a pseudogene has been identified on chromosome 14. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Mynn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Mynn APN 3 30613606 missense probably damaging 0.99
IGL01544:Mynn APN 3 30607705 nonsense probably null
IGL02084:Mynn APN 3 30611615 missense probably damaging 1.00
IGL02189:Mynn APN 3 30613544 splice site probably benign
IGL02261:Mynn APN 3 30607131 missense possibly damaging 0.67
IGL02541:Mynn APN 3 30611603 missense probably damaging 0.98
IGL02681:Mynn APN 3 30616642 missense probably benign 0.36
IGL03167:Mynn APN 3 30609042 missense probably damaging 1.00
PIT4494001:Mynn UTSW 3 30607722 nonsense probably null
R0049:Mynn UTSW 3 30607081 makesense probably null
R0321:Mynn UTSW 3 30607557 missense probably benign 0.01
R0420:Mynn UTSW 3 30607459 missense probably benign 0.42
R0576:Mynn UTSW 3 30607068 missense probably damaging 1.00
R1460:Mynn UTSW 3 30603704 missense probably damaging 0.99
R1882:Mynn UTSW 3 30616813 makesense probably null
R3115:Mynn UTSW 3 30607810 missense probably damaging 1.00
R3442:Mynn UTSW 3 30613563 missense probably damaging 0.99
R4930:Mynn UTSW 3 30607042 missense probably damaging 1.00
R5153:Mynn UTSW 3 30611589 missense probably benign 0.00
R5351:Mynn UTSW 3 30607542 missense probably benign 0.01
R7446:Mynn UTSW 3 30607052 missense probably benign 0.01
R7468:Mynn UTSW 3 30603676 missense probably damaging 1.00
R7543:Mynn UTSW 3 30607039 nonsense probably null
R8105:Mynn UTSW 3 30611479 missense possibly damaging 0.92
R8423:Mynn UTSW 3 30603784 missense probably benign 0.05
R8512:Mynn UTSW 3 30616649 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATGCTGTAAGCGAACAAGACTCC -3'
(R):5'- ACCCCAGGTCAGATTCGACCTAAG -3'

Sequencing Primer
(F):5'- CGTACAGAGAAGTCCCTTGTCAG -3'
(R):5'- AAGCCAGCACTGCCTGATG -3'
Posted On2013-06-11