Incidental Mutation 'R0574:Rhno1'
ID46569
Institutional Source Beutler Lab
Gene Symbol Rhno1
Ensembl Gene ENSMUSG00000048668
Gene NameRAD9-HUS1-RAD1 interacting nuclear orphan 1
Synonyms
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0574 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128357000-128362911 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 128358150 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001562] [ENSMUST00000057421] [ENSMUST00000073316] [ENSMUST00000112151] [ENSMUST00000112152] [ENSMUST00000133134] [ENSMUST00000155573] [ENSMUST00000157005] [ENSMUST00000203719] [ENSMUST00000223237]
Predicted Effect probably benign
Transcript: ENSMUST00000001562
SMART Domains Protein: ENSMUSP00000001562
Gene: ENSMUSG00000001521

DomainStartEndE-ValueType
Pfam:Tub_N 30 84 1.7e-23 PFAM
Pfam:Tub_N 76 198 5.5e-16 PFAM
Pfam:Tub 213 454 1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057421
AA Change: I70K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000054573
Gene: ENSMUSG00000048668
AA Change: I70K

DomainStartEndE-ValueType
Pfam:RHINO 1 233 1.1e-96 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073316
SMART Domains Protein: ENSMUSP00000073041
Gene: ENSMUSG00000001517

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 429 454 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
low complexity region 685 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112151
AA Change: I70K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107778
Gene: ENSMUSG00000048668
AA Change: I70K

DomainStartEndE-ValueType
Pfam:RHINO 1 233 1.4e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112152
AA Change: I70K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107779
Gene: ENSMUSG00000048668
AA Change: I70K

DomainStartEndE-ValueType
Pfam:RHINO 1 233 1.4e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132604
Predicted Effect probably benign
Transcript: ENSMUST00000133134
SMART Domains Protein: ENSMUSP00000145180
Gene: ENSMUSG00000001521

DomainStartEndE-ValueType
Pfam:Tub_N 35 76 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138313
Predicted Effect probably benign
Transcript: ENSMUST00000155573
AA Change: I70K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114836
Gene: ENSMUSG00000048668
AA Change: I70K

DomainStartEndE-ValueType
Pfam:RHINO 1 121 3.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000157005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180586
Predicted Effect probably benign
Transcript: ENSMUST00000203719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204148
Predicted Effect probably benign
Transcript: ENSMUST00000223237
AA Change: I70K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Rhno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01601:Rhno1 APN 6 128358058 missense probably damaging 0.98
R1688:Rhno1 UTSW 6 128357934 missense probably benign
R1754:Rhno1 UTSW 6 128357859 missense probably benign 0.01
R8333:Rhno1 UTSW 6 128357765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACATGCACTGACAGTTCTCCAC -3'
(R):5'- TGGGGCTGCCGTTCATTATTCAC -3'

Sequencing Primer
(F):5'- GACAGTTCTCCACAGCTCTGG -3'
(R):5'- TGTCATACCACATAGCTGGATGG -3'
Posted On2013-06-11