Incidental Mutation 'R0574:Nfkbib'
ID46570
Institutional Source Beutler Lab
Gene Symbol Nfkbib
Ensembl Gene ENSMUSG00000030595
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta
SynonymsIKappaBbeta, IkB
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0574 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28758251-28767512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28761788 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 145 (V145I)
Ref Sequence ENSEMBL: ENSMUSP00000117769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032815] [ENSMUST00000072965] [ENSMUST00000085851] [ENSMUST00000122915] [ENSMUST00000137121] [ENSMUST00000178767]
Predicted Effect probably benign
Transcript: ENSMUST00000032815
AA Change: V145I

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032815
Gene: ENSMUSG00000030595
AA Change: V145I

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 155 5.98e1 SMART
low complexity region 183 191 N/A INTRINSIC
ANK 206 235 5.12e-7 SMART
ANK 240 269 1.76e-5 SMART
ANK 273 303 1.37e2 SMART
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072965
SMART Domains Protein: ENSMUSP00000072732
Gene: ENSMUSG00000015149

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Pfam:SIR2 84 268 2.6e-60 PFAM
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085851
AA Change: V145I

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000083012
Gene: ENSMUSG00000030595
AA Change: V145I

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 155 5.98e1 SMART
low complexity region 183 191 N/A INTRINSIC
ANK 206 235 5.12e-7 SMART
ANK 240 269 1.76e-5 SMART
ANK 273 303 1.37e2 SMART
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122915
Predicted Effect probably benign
Transcript: ENSMUST00000137121
AA Change: V145I

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117769
Gene: ENSMUSG00000030595
AA Change: V145I

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 151 2.15e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178767
SMART Domains Protein: ENSMUSP00000137487
Gene: ENSMUSG00000096257

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
coiled coil region 129 151 N/A INTRINSIC
low complexity region 206 215 N/A INTRINSIC
coiled coil region 228 270 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: This gene encodes an inhibitor of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kappaB). The encoded protein prevents NF-kappaB-mediated transcription activation by sequestering it in the cytosol. In response to signals that induce NF-kappaB, such as cytokines and growth factors, the encoded protein undergoes phosphorylation, triggering its rapid ubiquitination and proteasomal degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased susceptibility to endotoxin shock and induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Nfkbib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01822:Nfkbib APN 7 28761709 missense probably benign 0.00
IGL02006:Nfkbib APN 7 28766242 critical splice donor site probably null
IGL02327:Nfkbib APN 7 28759143 missense probably benign 0.14
IGL02342:Nfkbib APN 7 28762103 missense probably damaging 1.00
IGL02610:Nfkbib APN 7 28759849 missense probably damaging 0.99
R1470:Nfkbib UTSW 7 28762022 splice site probably null
R1730:Nfkbib UTSW 7 28762055 missense probably damaging 1.00
R1783:Nfkbib UTSW 7 28762055 missense probably damaging 1.00
R4902:Nfkbib UTSW 7 28761748 nonsense probably null
R7291:Nfkbib UTSW 7 28759203 missense possibly damaging 0.62
R7297:Nfkbib UTSW 7 28766343 missense probably benign 0.07
R7890:Nfkbib UTSW 7 28762087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTAGCCTCCAGTCTTCATCACG -3'
(R):5'- TGATTCATCAGCATGAGCCCTTCC -3'

Sequencing Primer
(F):5'- AGTCTTCATCACGCGGCTC -3'
(R):5'- ATTGTCAGCGTGGCCCTAAC -3'
Posted On2013-06-11