Incidental Mutation 'R0574:Tbc1d17'
ID46572
Institutional Source Beutler Lab
Gene Symbol Tbc1d17
Ensembl Gene ENSMUSG00000038520
Gene NameTBC1 domain family, member 17
Synonyms
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0574 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44834623-44849079 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 44843123 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000033015] [ENSMUST00000047085] [ENSMUST00000118125] [ENSMUST00000145959] [ENSMUST00000207293] [ENSMUST00000207532]
Predicted Effect probably benign
Transcript: ENSMUST00000033015
SMART Domains Protein: ENSMUSP00000033015
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:AlaDh_PNT_C 42 93 1.3e-9 PFAM
Pfam:Thi4 53 100 1.8e-8 PFAM
Pfam:FAD_binding_3 59 94 1.4e-7 PFAM
Pfam:HI0933_like 59 161 1.3e-8 PFAM
Pfam:FAD_binding_2 60 100 1.5e-8 PFAM
Pfam:Pyr_redox 60 100 1.9e-8 PFAM
Pfam:Pyr_redox_2 60 125 7.3e-8 PFAM
Pfam:DAO 60 140 2.8e-9 PFAM
Pfam:NAD_binding_8 63 130 3.6e-17 PFAM
Pfam:Amino_oxidase 68 503 9.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047085
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118125
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130081
Predicted Effect probably benign
Transcript: ENSMUST00000133279
SMART Domains Protein: ENSMUSP00000133613
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
PDB:1TDO|A 2 44 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142098
Predicted Effect probably benign
Transcript: ENSMUST00000145959
SMART Domains Protein: ENSMUSP00000121546
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 5.8e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 544 3.91e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153161
Predicted Effect probably benign
Transcript: ENSMUST00000207293
Predicted Effect probably benign
Transcript: ENSMUST00000207532
Predicted Effect probably benign
Transcript: ENSMUST00000208714
Predicted Effect probably benign
Transcript: ENSMUST00000208890
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Tbc1d17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Tbc1d17 APN 7 44843085 missense probably benign 0.00
IGL00791:Tbc1d17 APN 7 44845313 missense probably benign 0.04
IGL01865:Tbc1d17 APN 7 44842689 missense possibly damaging 0.90
IGL02468:Tbc1d17 APN 7 44848329 missense probably benign
IGL02829:Tbc1d17 APN 7 44848872 unclassified probably benign
PIT4431001:Tbc1d17 UTSW 7 44845074 missense probably benign
R0035:Tbc1d17 UTSW 7 44841408 missense probably benign 0.09
R0035:Tbc1d17 UTSW 7 44841408 missense probably benign 0.09
R0066:Tbc1d17 UTSW 7 44844071 unclassified probably benign
R0066:Tbc1d17 UTSW 7 44844071 unclassified probably benign
R0414:Tbc1d17 UTSW 7 44846059 missense probably benign 0.00
R0626:Tbc1d17 UTSW 7 44843085 missense probably benign 0.00
R0960:Tbc1d17 UTSW 7 44848428 splice site probably benign
R1203:Tbc1d17 UTSW 7 44843471 missense probably damaging 1.00
R1244:Tbc1d17 UTSW 7 44844398 missense probably damaging 0.99
R1730:Tbc1d17 UTSW 7 44845131 missense probably damaging 0.99
R1783:Tbc1d17 UTSW 7 44845131 missense probably damaging 0.99
R1899:Tbc1d17 UTSW 7 44841633 unclassified probably benign
R1953:Tbc1d17 UTSW 7 44841398 splice site probably null
R2106:Tbc1d17 UTSW 7 44848268 critical splice donor site probably null
R3889:Tbc1d17 UTSW 7 44845938 missense probably damaging 1.00
R4240:Tbc1d17 UTSW 7 44846826 missense probably damaging 1.00
R4547:Tbc1d17 UTSW 7 44841347 missense probably benign
R4787:Tbc1d17 UTSW 7 44843064 missense probably benign 0.02
R5422:Tbc1d17 UTSW 7 44848868 start codon destroyed probably null 0.98
R5569:Tbc1d17 UTSW 7 44848331 missense probably damaging 1.00
R5933:Tbc1d17 UTSW 7 44845337 missense probably damaging 0.96
R6502:Tbc1d17 UTSW 7 44841625 missense probably benign 0.30
R6838:Tbc1d17 UTSW 7 44844314 missense probably damaging 0.97
R7543:Tbc1d17 UTSW 7 44846079 missense probably benign 0.00
R8118:Tbc1d17 UTSW 7 44843002 missense probably benign 0.10
Z1177:Tbc1d17 UTSW 7 44842671 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACTCATACCCTGAACGTAGCCTG -3'
(R):5'- TGCATGGATACCGAAGCCTCATTG -3'

Sequencing Primer
(F):5'- CGTAGCCTGAGGGAACAC -3'
(R):5'- AGATTGGGTGGCCTTACCTC -3'
Posted On2013-06-11