Incidental Mutation 'R0574:Snx3'
ID46579
Institutional Source Beutler Lab
Gene Symbol Snx3
Ensembl Gene ENSMUSG00000019804
Gene Namesorting nexin 3
SynonymsSDP3
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0574 (G1)
Quality Score139
Status Validated
Chromosome10
Chromosomal Location42502030-42535381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42502387 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 19 (N19K)
Ref Sequence ENSEMBL: ENSMUSP00000101138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019939] [ENSMUST00000105499] [ENSMUST00000105500]
Predicted Effect probably benign
Transcript: ENSMUST00000019939
AA Change: N19K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019939
Gene: ENSMUSG00000019804
AA Change: N19K

DomainStartEndE-ValueType
PX 26 148 9.8e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105499
AA Change: N19K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101138
Gene: ENSMUSG00000019804
AA Change: N19K

DomainStartEndE-ValueType
PX 26 116 3.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105500
AA Change: N19K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101139
Gene: ENSMUSG00000019804
AA Change: N19K

DomainStartEndE-ValueType
PX 3 126 1.85e-20 SMART
Meta Mutation Damage Score 0.0984 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like most family members. This protein interacts with phosphatidylinositol-3-phosphate, and is involved in protein trafficking. A pseudogene of this gene is present on the sex chromosomes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Snx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02904:Snx3 APN 10 42534694 missense probably damaging 1.00
sorta UTSW 10 42534731 nonsense probably null
R0582:Snx3 UTSW 10 42533280 splice site probably benign
R6112:Snx3 UTSW 10 42526046 missense probably benign 0.12
R6375:Snx3 UTSW 10 42534731 nonsense probably null
R6563:Snx3 UTSW 10 42526036 missense possibly damaging 0.54
R7978:Snx3 UTSW 10 42502350 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCGCCCGAGGCATTGTGGTTATTG -3'
(R):5'- TTCCAGCACCTTCTACCGGAGCCAG -3'

Sequencing Primer
(F):5'- CTGTTTCTCCCTGGGCAGAG -3'
(R):5'- TGGTCCCCATACAAACTGTC -3'
Posted On2013-06-11