Incidental Mutation 'R0574:Stx8'
ID46580
Institutional Source Beutler Lab
Gene Symbol Stx8
Ensembl Gene ENSMUSG00000020903
Gene Namesyntaxin 8
Synonyms
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0574 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67966193-68207148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67973252 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 46 (T46M)
Ref Sequence ENSEMBL: ENSMUSP00000104315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021285] [ENSMUST00000021286] [ENSMUST00000108675]
Predicted Effect probably benign
Transcript: ENSMUST00000021285
AA Change: T46M

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021285
Gene: ENSMUSG00000020903
AA Change: T46M

DomainStartEndE-ValueType
low complexity region 47 63 N/A INTRINSIC
t_SNARE 140 207 2.77e-13 SMART
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000021286
AA Change: T46M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021286
Gene: ENSMUSG00000020903
AA Change: T46M

DomainStartEndE-ValueType
low complexity region 47 63 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108675
AA Change: T46M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104315
Gene: ENSMUSG00000020903
AA Change: T46M

DomainStartEndE-ValueType
low complexity region 47 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148642
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the syntaxin family. The encoded protein is involved in protein trafficking from early to late endosomes via vesicle fusion and exocytosis. A related pseudogene has been identified on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in platelet dense granule secretion, aggregation, and thrombus stability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Stx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Stx8 APN 11 67969772 missense probably damaging 1.00
IGL02860:Stx8 APN 11 67984565 missense probably damaging 1.00
IGL03084:Stx8 APN 11 68020956 nonsense probably null
R0599:Stx8 UTSW 11 68109362 missense probably null 0.26
R1696:Stx8 UTSW 11 68011422 missense probably damaging 1.00
R1816:Stx8 UTSW 11 68011326 missense possibly damaging 0.95
R1928:Stx8 UTSW 11 68109280 missense probably damaging 0.98
R2352:Stx8 UTSW 11 67973251 missense probably benign 0.02
R4822:Stx8 UTSW 11 67973273 missense possibly damaging 0.90
R5485:Stx8 UTSW 11 68020966 missense probably benign 0.00
R7673:Stx8 UTSW 11 67984639 missense probably benign 0.29
R7722:Stx8 UTSW 11 68203718 missense probably damaging 1.00
R7832:Stx8 UTSW 11 68109280 missense probably damaging 1.00
R7852:Stx8 UTSW 11 67969785 missense probably damaging 0.99
R8343:Stx8 UTSW 11 68020988 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGGACCAGGTTGCCATGAACAG -3'
(R):5'- GCAACAGTGTGGAAACCAAGTCCTC -3'

Sequencing Primer
(F):5'- TGCACTATGGGTACAAGCTC -3'
(R):5'- CCTCCTTGAGCTGTGGAAAAATC -3'
Posted On2013-06-11