Incidental Mutation 'R0574:Pole2'
ID46583
Institutional Source Beutler Lab
Gene Symbol Pole2
Ensembl Gene ENSMUSG00000020974
Gene Namepolymerase (DNA directed), epsilon 2 (p59 subunit)
SynonymsDNA polymerase epsilon small subunit
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0574 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69201773-69228195 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 69211457 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021359] [ENSMUST00000221411]
Predicted Effect probably benign
Transcript: ENSMUST00000021359
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221806
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Pole2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pole2 APN 12 69226445 splice site probably benign
IGL00940:Pole2 APN 12 69215360 missense probably damaging 1.00
IGL01593:Pole2 APN 12 69223099 splice site probably null
IGL01609:Pole2 APN 12 69207857 critical splice donor site probably null
IGL01717:Pole2 APN 12 69213849 missense probably damaging 1.00
IGL02168:Pole2 APN 12 69201886 unclassified probably benign
IGL02208:Pole2 APN 12 69223162 missense possibly damaging 0.91
IGL02966:Pole2 APN 12 69209875 missense probably damaging 1.00
PIT4504001:Pole2 UTSW 12 69209985 nonsense probably null
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0396:Pole2 UTSW 12 69222386 splice site probably benign
R0620:Pole2 UTSW 12 69209879 missense probably damaging 1.00
R0685:Pole2 UTSW 12 69211413 missense probably damaging 0.98
R0791:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1452:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1453:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1455:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1912:Pole2 UTSW 12 69209990 missense probably damaging 0.99
R2067:Pole2 UTSW 12 69228152 missense probably benign 0.01
R2929:Pole2 UTSW 12 69209938 missense probably benign 0.13
R3016:Pole2 UTSW 12 69222062 missense probably benign 0.14
R4504:Pole2 UTSW 12 69222468 missense probably benign 0.00
R4765:Pole2 UTSW 12 69222052 missense possibly damaging 0.49
R4790:Pole2 UTSW 12 69226365 missense probably benign 0.00
R4896:Pole2 UTSW 12 69223150 missense probably damaging 0.97
R6998:Pole2 UTSW 12 69213906 missense possibly damaging 0.82
R7257:Pole2 UTSW 12 69202910 missense probably damaging 1.00
R7535:Pole2 UTSW 12 69222429 missense probably benign 0.10
R7841:Pole2 UTSW 12 69204258 missense probably damaging 1.00
R8437:Pole2 UTSW 12 69204187 nonsense probably null
R8506:Pole2 UTSW 12 69208960 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTTTCACAGTGTGCCGCAG -3'
(R):5'- GCTCTTCAGCAAGTGCTATAACCCC -3'

Sequencing Primer
(F):5'- GCGCTGCACATTTACAGAG -3'
(R):5'- CCCCACCCTAAAATATGAGTTAGTTG -3'
Posted On2013-06-11