Incidental Mutation 'R0574:Prl8a2'
ID46586
Institutional Source Beutler Lab
Gene Symbol Prl8a2
Ensembl Gene ENSMUSG00000018259
Gene Nameprolactin family 8, subfamily a, member 2
SynonymsDPRP, Dtprp, D/tPRP, mdPRP
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0574 (G1)
Quality Score216
Status Validated
Chromosome13
Chromosomal Location27345673-27354216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27348900 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 32 (C32S)
Ref Sequence ENSEMBL: ENSMUSP00000105992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018403] [ENSMUST00000110363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018403
AA Change: C33S

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018403
Gene: ENSMUSG00000018259
AA Change: C33S

DomainStartEndE-ValueType
Pfam:Hormone_1 16 240 6.4e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110363
AA Change: C32S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105992
Gene: ENSMUSG00000018259
AA Change: C32S

DomainStartEndE-ValueType
Pfam:Hormone_1 15 239 2.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223918
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced pregnancy success when exposed to hypoxic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Prl8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02654:Prl8a2 APN 13 27352797 missense possibly damaging 0.56
IGL03268:Prl8a2 APN 13 27353955 missense probably benign 0.09
R0557:Prl8a2 UTSW 13 27352892 nonsense probably null
R1166:Prl8a2 UTSW 13 27353952 missense possibly damaging 0.53
R1401:Prl8a2 UTSW 13 27353996 missense possibly damaging 0.55
R1875:Prl8a2 UTSW 13 27351054 missense probably benign 0.02
R2420:Prl8a2 UTSW 13 27348913 missense possibly damaging 0.46
R4152:Prl8a2 UTSW 13 27351002 missense possibly damaging 0.86
R5285:Prl8a2 UTSW 13 27350133 splice site probably null
R6452:Prl8a2 UTSW 13 27352797 missense probably benign 0.08
R6906:Prl8a2 UTSW 13 27348917 missense probably benign 0.03
R7217:Prl8a2 UTSW 13 27351015 missense possibly damaging 0.89
R7490:Prl8a2 UTSW 13 27352770 missense possibly damaging 0.47
R8170:Prl8a2 UTSW 13 27352811 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTAAGCTGCACTGTCCTTGTCC -3'
(R):5'- CCCCTAGTATCAGTAGTTGGTGCCTC -3'

Sequencing Primer
(F):5'- CTGGACTAAGTGCTCACAGTG -3'
(R):5'- GTGCCTCTTTTACCTATGAAGATG -3'
Posted On2013-06-11