Incidental Mutation 'R0574:Itga1'
ID46587
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Nameintegrin alpha 1
SynonymsCD49A, Vla1, E130012M19Rik
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R0574 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location114953096-115101964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 114966561 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1111 (S1111R)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
Predicted Effect probably damaging
Transcript: ENSMUST00000061673
AA Change: S1111R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: S1111R

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Meta Mutation Damage Score 0.1013 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 114992363 missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115031193 missense probably benign 0.00
IGL00549:Itga1 APN 13 115049296 missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115012249 missense probably damaging 1.00
IGL01021:Itga1 APN 13 114997000 missense probably benign 0.29
IGL01289:Itga1 APN 13 114986226 missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115006948 missense possibly damaging 0.73
IGL01791:Itga1 APN 13 114987661 missense probably benign 0.00
IGL01796:Itga1 APN 13 114985121 missense probably damaging 1.00
IGL02027:Itga1 APN 13 114990055 splice site probably null
IGL02330:Itga1 APN 13 115012204 missense probably damaging 1.00
IGL02480:Itga1 APN 13 114987648 missense probably damaging 1.00
IGL02943:Itga1 APN 13 115049296 missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0244:Itga1 UTSW 13 115006897 splice site probably benign
R0265:Itga1 UTSW 13 114992459 missense probably benign
R0302:Itga1 UTSW 13 115012318 splice site probably benign
R0320:Itga1 UTSW 13 114977594 splice site probably benign
R0389:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0443:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0646:Itga1 UTSW 13 114968299 missense probably benign
R0830:Itga1 UTSW 13 115007032 missense probably benign 0.08
R2162:Itga1 UTSW 13 115030910 missense probably benign 0.23
R2216:Itga1 UTSW 13 114997029 missense probably benign 0.00
R2403:Itga1 UTSW 13 114977614 missense probably benign 0.00
R3734:Itga1 UTSW 13 114977639 missense probably benign
R4171:Itga1 UTSW 13 115030886 nonsense probably null
R4402:Itga1 UTSW 13 115001566 missense probably benign 0.00
R4675:Itga1 UTSW 13 115001691 splice site probably null
R4684:Itga1 UTSW 13 115049370 missense probably damaging 1.00
R4795:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4796:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4845:Itga1 UTSW 13 114974172 nonsense probably null
R5147:Itga1 UTSW 13 114985142 missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115035303 missense probably benign
R5234:Itga1 UTSW 13 115049303 nonsense probably null
R5344:Itga1 UTSW 13 115002309 missense possibly damaging 0.78
R5554:Itga1 UTSW 13 114992474 nonsense probably null
R5662:Itga1 UTSW 13 114986171 missense probably benign 0.03
R5945:Itga1 UTSW 13 114966590 missense probably benign 0.02
R6150:Itga1 UTSW 13 114968233 missense probably benign 0.01
R6241:Itga1 UTSW 13 114960137 splice site probably null
R6276:Itga1 UTSW 13 114980852 missense probably benign
R6369:Itga1 UTSW 13 114965660 missense probably damaging 1.00
R6511:Itga1 UTSW 13 114992501 missense probably damaging 0.98
R6663:Itga1 UTSW 13 114974105 missense probably benign 0.02
R6783:Itga1 UTSW 13 114996977 missense probably benign 0.22
R6931:Itga1 UTSW 13 115001563 missense probably benign 0.39
R7069:Itga1 UTSW 13 114968240 missense probably damaging 1.00
R7458:Itga1 UTSW 13 114986266 missense probably benign 0.00
R7588:Itga1 UTSW 13 114968249 missense possibly damaging 0.88
R7591:Itga1 UTSW 13 114982779 missense probably damaging 1.00
R7597:Itga1 UTSW 13 114974140 missense probably benign 0.28
R7615:Itga1 UTSW 13 114996922 missense probably null 0.99
R7756:Itga1 UTSW 13 114992460 missense probably benign 0.04
R7795:Itga1 UTSW 13 115012236 missense probably damaging 1.00
R7819:Itga1 UTSW 13 115049301 missense probably damaging 0.99
Z1177:Itga1 UTSW 13 114985071 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGAGCGTCCGTTCAATCGCTG -3'
(R):5'- TGTGGCACGCCATATTCATGATGTAAG -3'

Sequencing Primer
(F):5'- GTTCAATCGCTGCTTACACC -3'
(R):5'- ggaaagaggggagcacaag -3'
Posted On2013-06-11