Incidental Mutation 'R0574:Olfr727'
ID46588
Institutional Source Beutler Lab
Gene Symbol Olfr727
Ensembl Gene ENSMUSG00000059488
Gene Nameolfactory receptor 727
SynonymsGA_x6K02T2PMLR-5817082-5818056, MOR246-2
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0574 (G1)
Quality Score201
Status Validated
Chromosome14
Chromosomal Location50123186-50128746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50126682 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 35 (Y35F)
Ref Sequence ENSEMBL: ENSMUSP00000149886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079142] [ENSMUST00000215317]
Predicted Effect probably damaging
Transcript: ENSMUST00000079142
AA Change: Y35F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078145
Gene: ENSMUSG00000059488
AA Change: Y35F

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 290 1.5e-7 PFAM
Pfam:7tm_1 41 287 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205947
Predicted Effect probably damaging
Transcript: ENSMUST00000215317
AA Change: Y35F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0912 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Olfr727
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Olfr727 APN 14 50126757 missense probably damaging 1.00
IGL01306:Olfr727 APN 14 50126582 missense probably benign 0.00
ANU23:Olfr727 UTSW 14 50126582 missense probably benign 0.00
R0498:Olfr727 UTSW 14 50127293 missense probably damaging 1.00
R1201:Olfr727 UTSW 14 50127356 missense probably damaging 1.00
R2112:Olfr727 UTSW 14 50126623 missense probably damaging 1.00
R2435:Olfr727 UTSW 14 50126754 missense probably damaging 1.00
R4238:Olfr727 UTSW 14 50127432 missense probably benign
R4611:Olfr727 UTSW 14 50127073 missense probably benign 0.12
R4663:Olfr727 UTSW 14 50127482 missense probably benign 0.00
R4672:Olfr727 UTSW 14 50127257 missense probably benign 0.02
R5022:Olfr727 UTSW 14 50127012 missense possibly damaging 0.78
R5062:Olfr727 UTSW 14 50127437 missense probably damaging 1.00
R5924:Olfr727 UTSW 14 50126682 missense probably damaging 1.00
R6702:Olfr727 UTSW 14 50127231 missense probably damaging 1.00
R6703:Olfr727 UTSW 14 50127231 missense probably damaging 1.00
R7497:Olfr727 UTSW 14 50127495 missense probably benign 0.20
R7615:Olfr727 UTSW 14 50126989 missense probably benign 0.07
R7798:Olfr727 UTSW 14 50127438 missense probably damaging 1.00
R8413:Olfr727 UTSW 14 50127370 missense probably benign 0.19
R8439:Olfr727 UTSW 14 50127147 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAACAGAGTTACCAGGACTCAGTG -3'
(R):5'- TCTGAGCCAAGCAGGCTTCAAAAG -3'

Sequencing Primer
(F):5'- tgtccttcctgtccttctttc -3'
(R):5'- CCAAGCAGGCTTCAAAAGATATTG -3'
Posted On2013-06-11