Incidental Mutation 'R0574:Adamts5'
ID46589
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms9530092O11Rik, ADAM-TS5
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R0574 (G1)
Quality Score216
Status Validated
Chromosome16
Chromosomal Location85856173-85901828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85899484 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 262 (S262P)
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
Predicted Effect probably damaging
Transcript: ENSMUST00000023611
AA Change: S262P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: S262P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Meta Mutation Damage Score 0.1644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85899834 missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85863133 missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85899475 missense probably benign 0.03
IGL01616:Adamts5 APN 16 85887814 splice site probably null
IGL02551:Adamts5 APN 16 85870038 missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85869942 missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85877945 missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85868195 missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85863014 missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85877906 missense probably damaging 1.00
R0419:Adamts5 UTSW 16 85866642 missense probably benign 0.00
R0539:Adamts5 UTSW 16 85868692 missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85899247 missense probably damaging 1.00
R0669:Adamts5 UTSW 16 85899726 missense probably benign 0.45
R1454:Adamts5 UTSW 16 85869993 missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85900102 missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85877915 nonsense probably null
R1753:Adamts5 UTSW 16 85899352 missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85877915 nonsense probably null
R1906:Adamts5 UTSW 16 85868685 nonsense probably null
R1946:Adamts5 UTSW 16 85899243 missense probably damaging 1.00
R2180:Adamts5 UTSW 16 85887924 missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85899306 missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85862758 missense probably damaging 1.00
R3889:Adamts5 UTSW 16 85868121 missense probably damaging 1.00
R4214:Adamts5 UTSW 16 85868643 missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85900066 nonsense probably null
R5119:Adamts5 UTSW 16 85899578 missense probably benign 0.00
R5230:Adamts5 UTSW 16 85870068 missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85869912 critical splice donor site probably null
R5652:Adamts5 UTSW 16 85899268 missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85868118 missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85899300 missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85899753 missense probably benign 0.03
R6384:Adamts5 UTSW 16 85862828 missense probably benign 0.00
R6724:Adamts5 UTSW 16 85868557 missense probably benign 0.06
R6829:Adamts5 UTSW 16 85870071 missense possibly damaging 0.52
R7066:Adamts5 UTSW 16 85862764 missense probably damaging 1.00
R7256:Adamts5 UTSW 16 85863035 missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85899945 missense probably benign 0.10
R7298:Adamts5 UTSW 16 85899918 missense probably benign 0.35
R7384:Adamts5 UTSW 16 85899826 missense probably benign 0.02
R7452:Adamts5 UTSW 16 85877981 missense probably benign 0.00
R7727:Adamts5 UTSW 16 85899966 missense probably damaging 1.00
R7785:Adamts5 UTSW 16 85863004 missense probably damaging 0.99
R7894:Adamts5 UTSW 16 85877920 nonsense probably null
R8111:Adamts5 UTSW 16 85899315 missense probably damaging 1.00
R8370:Adamts5 UTSW 16 85899993 missense possibly damaging 0.74
R8413:Adamts5 UTSW 16 85866618 critical splice donor site probably null
R8505:Adamts5 UTSW 16 85900056 missense probably benign 0.42
X0062:Adamts5 UTSW 16 85863157 missense probably damaging 1.00
Z1177:Adamts5 UTSW 16 85870074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTGCATCGTAGTGCTCTTC -3'
(R):5'- ATCCTGCATGTCTACAACCGCGAG -3'

Sequencing Primer
(F):5'- AGACTCGTGTCCTTGTCCG -3'
(R):5'- TACAACCGCGAGGGCTTTAG -3'
Posted On2013-06-11