Mutagenetix > Incidental Mutations

Incidental Mutation 'R0574:Ift140'

46590

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

038764-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0574 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 25051760 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000024983] [ENSMUST00000137386] [ENSMUST00000137386] [ENSMUST00000137386] [ENSMUST00000137386]

Predicted Effect

probably null
Transcript: ENSMUST00000024983

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000024983

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000137386

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000137386

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000137386

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000137386

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153895

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.4%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700099C18Rik	T	C	17: 94,761,491		noncoding transcript	Het
Abca14	A	G	7: 120,224,497	I416V	probably damaging	Het
Actrt3	T	C	3: 30,599,680	E57G	probably benign	Het
Adamts5	A	G	16: 85,899,484	S262P	probably damaging	Het
Aldh1a2	T	C	9: 71,281,708		probably null	Het
Arhgap29	A	G	3: 122,007,625	I670V	probably benign	Het
Bptf	T	C	11: 107,076,527	D1009G	probably damaging	Het
Ddr2	G	T	1: 169,981,963		probably benign	Het
Itga1	A	C	13: 114,966,561	S1111R	probably damaging	Het
Klk1b27	T	A	7: 44,056,101	L199Q	probably damaging	Het
Lhx3	T	C	2: 26,201,311	S329G	probably benign	Het
Man2b1	T	G	8: 85,096,776	M913R	probably benign	Het
Mmp15	G	A	8: 95,365,401	A80T	possibly damaging	Het
Mpo	A	T	11: 87,796,076	Y177F	probably damaging	Het
Mynn	T	C	3: 30,616,739	S587P	probably benign	Het
Nfkbib	C	T	7: 28,761,788	V145I	probably benign	Het
Olfr421-ps1	T	C	1: 174,151,566	F17L	probably benign	Het
Olfr727	A	T	14: 50,126,682	Y35F	probably damaging	Het
Olfr98	G	T	17: 37,262,881	S261Y	probably damaging	Het
Pole2	G	A	12: 69,211,457		probably benign	Het
Ppargc1b	C	T	18: 61,302,739	G906D	probably benign	Het
Prl8a2	T	A	13: 27,348,900	C32S	probably damaging	Het
Rhno1	A	T	6: 128,358,150		probably null	Het
Rprd2	T	C	3: 95,774,357	E408G	possibly damaging	Het
Ryr2	T	A	13: 11,731,669	H1999L	probably benign	Het
Shprh	T	C	10: 11,163,077		probably benign	Het
Snx3	T	A	10: 42,502,387	N19K	probably benign	Het
Stx8	C	T	11: 67,973,252	T46M	probably damaging	Het
Tbc1d17	A	G	7: 44,843,123		probably benign	Het
Ush1c	A	G	7: 46,196,804	S855P	possibly damaging	Het
Usp54	A	G	14: 20,556,254	V1338A	probably benign	Het
Vmn1r214	A	G	13: 23,034,493	I52M	probably benign	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	unclassified	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCGTGATCCTCAAATGCCAGC -3'
(R):5'- CAGAAACCTGAGTAGTGACAGCAGC -3'

Sequencing Primer
(F):5'- TGCCAGCGTGGTAAAATAGAC -3'
(R):5'- GTTTGCCTTTAGAAGGAAAGCC -3'

Posted On

2013-06-11