Incidental Mutation 'R0062:Cnbd1'
Institutional Source Beutler Lab
Gene Symbol Cnbd1
Ensembl Gene ENSMUSG00000073991
Gene Namecyclic nucleotide binding domain containing 1
MMRRC Submission 038354-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0062 (G1)
Quality Score225
Status Validated
Chromosomal Location18860454-19122526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18860504 bp
Amino Acid Change Isoleucine to Threonine at position 414 (I414T)
Ref Sequence ENSEMBL: ENSMUSP00000121576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137780]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133363
Predicted Effect possibly damaging
Transcript: ENSMUST00000137780
AA Change: I414T

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121576
Gene: ENSMUSG00000073991
AA Change: I414T

low complexity region 21 34 N/A INTRINSIC
Blast:cNMP 166 225 6e-6 BLAST
SCOP:d1cx4a1 296 430 3e-13 SMART
Blast:cNMP 318 429 2e-60 BLAST
Meta Mutation Damage Score 0.1762 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G T 10: 120,778,606 probably benign Het
4930407I10Rik T A 15: 82,063,066 I388K probably benign Het
4930407I10Rik T A 15: 82,066,303 V1467D probably damaging Het
Abi2 T A 1: 60,453,725 N182K probably benign Het
Adam25 A T 8: 40,754,792 H365L probably damaging Het
Ankfy1 T A 11: 72,712,204 Y20N probably damaging Het
Aqp11 C T 7: 97,737,861 V43M probably benign Het
Arhgef10l A T 4: 140,552,532 L503Q probably damaging Het
Arhgef28 A T 13: 97,956,642 I977N possibly damaging Het
Armc4 T A 18: 7,129,593 probably benign Het
Cacna1b A G 2: 24,758,331 Y161H probably damaging Het
Cacna1c T C 6: 118,602,237 D1480G probably damaging Het
Clk3 A G 9: 57,752,166 M533T probably damaging Het
Commd3 A T 2: 18,674,703 probably null Het
Crybg1 G T 10: 43,997,906 Q1069K probably damaging Het
Dnah8 T A 17: 30,765,711 F3128I probably damaging Het
Dnmt3b C T 2: 153,672,272 P382S probably benign Het
Dock1 A G 7: 134,777,495 probably null Het
Dpysl3 C T 18: 43,333,876 probably null Het
Ebf2 T A 14: 67,238,540 probably benign Het
F830045P16Rik T C 2: 129,463,704 E250G possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fetub T C 16: 22,929,086 probably benign Het
Fmn2 A T 1: 174,608,449 probably benign Het
Fryl T C 5: 73,022,278 I2929V probably benign Het
Gm11232 T A 4: 71,756,875 Q130L possibly damaging Het
Gm9637 G T 14: 19,402,570 noncoding transcript Het
Gna15 A G 10: 81,512,405 probably null Het
Gtf3c5 T C 2: 28,572,186 probably benign Het
Irs2 G A 8: 11,005,723 T903I possibly damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Izumo1 A G 7: 45,627,197 T395A probably benign Het
Kcnd2 G A 6: 21,727,226 V593M possibly damaging Het
Kprp T C 3: 92,824,682 S354G probably damaging Het
Krt72 T C 15: 101,786,008 K151E probably damaging Het
Letm2 A T 8: 25,587,448 probably benign Het
Lipe A G 7: 25,398,449 V23A possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Mef2c A G 13: 83,652,873 N231D possibly damaging Het
Mtdh T A 15: 34,134,280 probably benign Het
Mthfd1 G A 12: 76,297,589 probably benign Het
Nbeal1 C A 1: 60,247,717 N899K probably benign Het
Noc3l T C 19: 38,814,809 S129G probably benign Het
Olfr1223 T C 2: 89,144,622 I134V possibly damaging Het
Olfr1338 T C 4: 118,753,903 I212V probably benign Het
Olfr171 T C 16: 19,624,417 M228V probably benign Het
Olfr905 T A 9: 38,473,258 D170E probably benign Het
Pik3r6 T A 11: 68,528,809 Y149N probably damaging Het
Pja2 C A 17: 64,308,971 V310L probably damaging Het
Plcd3 G A 11: 103,074,894 A504V probably benign Het
Rint1 G A 5: 23,787,828 probably benign Het
Ripor3 A G 2: 167,984,438 probably benign Het
Rpa2 C A 4: 132,777,814 N251K probably damaging Het
Rttn T C 18: 89,010,966 probably null Het
Ryr2 C T 13: 11,869,116 probably null Het
Scara3 T C 14: 65,930,968 N400S probably damaging Het
Slc7a6 G T 8: 106,189,631 V180L possibly damaging Het
Slc7a6 T A 8: 106,189,632 V180E probably damaging Het
Slc8b1 T A 5: 120,521,863 probably null Het
Slco1a4 G A 6: 141,819,479 Q346* probably null Het
Stk32b A G 5: 37,461,448 S229P probably damaging Het
Syde2 A G 3: 145,998,753 R487G probably benign Het
Tbc1d2b T C 9: 90,222,302 probably benign Het
Ticrr T C 7: 79,667,906 V396A probably benign Het
Trrap T C 5: 144,782,193 probably benign Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Wdr36 T G 18: 32,864,749 V820G possibly damaging Het
Wdr83 G A 8: 85,079,827 T114I possibly damaging Het
Zc3h7a T C 16: 11,139,147 N866S probably damaging Het
Zfc3h1 A G 10: 115,416,753 K1324E probably benign Het
Other mutations in Cnbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Cnbd1 APN 4 18906988 splice site probably benign
IGL01101:Cnbd1 APN 4 18907098 missense probably benign 0.30
IGL01365:Cnbd1 APN 4 18860576 missense probably damaging 1.00
IGL01646:Cnbd1 APN 4 18895141 nonsense probably null
IGL02106:Cnbd1 APN 4 18894993 missense possibly damaging 0.55
IGL02218:Cnbd1 APN 4 18887739 missense probably benign 0.00
IGL02335:Cnbd1 APN 4 19055095 missense possibly damaging 0.87
IGL02380:Cnbd1 APN 4 18887748 critical splice acceptor site probably null
IGL02380:Cnbd1 APN 4 18887749 critical splice acceptor site probably null
IGL02404:Cnbd1 APN 4 18895047 missense possibly damaging 0.64
IGL03293:Cnbd1 APN 4 18860565 missense possibly damaging 0.65
IGL03301:Cnbd1 APN 4 19055039 missense probably benign 0.00
IGL03342:Cnbd1 APN 4 19098264 splice site probably benign
IGL03392:Cnbd1 APN 4 18862111 missense probably damaging 1.00
R0062:Cnbd1 UTSW 4 18860504 missense possibly damaging 0.65
R0195:Cnbd1 UTSW 4 18906988 splice site probably benign
R0462:Cnbd1 UTSW 4 18895044 missense probably benign 0.01
R0909:Cnbd1 UTSW 4 19122444 missense probably benign
R1435:Cnbd1 UTSW 4 18907026 missense probably benign 0.00
R1995:Cnbd1 UTSW 4 19055112 missense possibly damaging 0.55
R2495:Cnbd1 UTSW 4 18860579 missense probably damaging 1.00
R3974:Cnbd1 UTSW 4 18887693 missense probably benign 0.00
R4083:Cnbd1 UTSW 4 18886042 missense possibly damaging 0.88
R4494:Cnbd1 UTSW 4 19098150 missense probably benign 0.34
R4558:Cnbd1 UTSW 4 19055095 missense possibly damaging 0.87
R4833:Cnbd1 UTSW 4 18862120 missense probably damaging 0.97
R5326:Cnbd1 UTSW 4 18860517 missense possibly damaging 0.67
R5542:Cnbd1 UTSW 4 18860517 missense possibly damaging 0.67
R5930:Cnbd1 UTSW 4 18886119 missense probably benign 0.14
R5958:Cnbd1 UTSW 4 18862056 missense probably benign 0.31
R6064:Cnbd1 UTSW 4 18895084 missense probably benign 0.14
R6250:Cnbd1 UTSW 4 19098255 missense probably benign 0.00
R6348:Cnbd1 UTSW 4 18860462 missense probably damaging 0.99
R7027:Cnbd1 UTSW 4 18862063 missense probably benign 0.01
R7905:Cnbd1 UTSW 4 18907100 missense possibly damaging 0.81
R7988:Cnbd1 UTSW 4 18907100 missense possibly damaging 0.81
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- catcatcaccaccatcatcatc -3'
Posted On2013-06-11