Incidental Mutation 'R0062:Lipe'
ID46619
Institutional Source Beutler Lab
Gene Symbol Lipe
Ensembl Gene ENSMUSG00000003123
Gene Namelipase, hormone sensitive
Synonyms4933403G17Rik, HSL
MMRRC Submission 038354-MU
Accession Numbers

Genbank: NM_010719, NM_001039507; MGI: 96790

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0062 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25379527-25398710 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25398449 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 23 (V23A)
Ref Sequence ENSEMBL: ENSMUSP00000100811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003207] [ENSMUST00000074040] [ENSMUST00000105177] [ENSMUST00000149349] [ENSMUST00000200880]
Predicted Effect probably benign
Transcript: ENSMUST00000003207
SMART Domains Protein: ENSMUSP00000003207
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
Pfam:HSL_N 44 358 4.6e-148 PFAM
Pfam:DUF2424 345 504 1.1e-8 PFAM
Pfam:Abhydrolase_3 388 548 3e-36 PFAM
low complexity region 611 626 N/A INTRINSIC
Pfam:Abhydrolase_3 684 771 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074040
SMART Domains Protein: ENSMUSP00000073687
Gene: ENSMUSG00000060188

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 126 2.8e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105177
AA Change: V23A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100811
Gene: ENSMUSG00000003123
AA Change: V23A

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149349
AA Change: V23A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123485
Gene: ENSMUSG00000003123
AA Change: V23A

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Pfam:HSL_N 319 627 1.2e-116 PFAM
Pfam:DUF2424 616 774 1.2e-8 PFAM
Pfam:Abhydrolase_3 658 817 1.9e-34 PFAM
low complexity region 881 896 N/A INTRINSIC
Pfam:Abhydrolase_3 951 1041 2.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200880
SMART Domains Protein: ENSMUSP00000144096
Gene: ENSMUSG00000060188

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 111 2.8e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206436
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has a long and a short form, generated by use of alternative translational start codons. The long form is expressed in steroidogenic tissues such as testis, where it converts cholesteryl esters to free cholesterol for steroid hormone production. The short form is expressed in adipose tissue, among others, where it hydrolyzes stored triglycerides to free fatty acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations of this locus result in abnormal lipid homeostasis and, in some lines, defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(5) Gene trapped(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G T 10: 120,778,606 probably benign Het
4930407I10Rik T A 15: 82,063,066 I388K probably benign Het
4930407I10Rik T A 15: 82,066,303 V1467D probably damaging Het
Abi2 T A 1: 60,453,725 N182K probably benign Het
Adam25 A T 8: 40,754,792 H365L probably damaging Het
Ankfy1 T A 11: 72,712,204 Y20N probably damaging Het
Aqp11 C T 7: 97,737,861 V43M probably benign Het
Arhgef10l A T 4: 140,552,532 L503Q probably damaging Het
Arhgef28 A T 13: 97,956,642 I977N possibly damaging Het
Armc4 T A 18: 7,129,593 probably benign Het
Cacna1b A G 2: 24,758,331 Y161H probably damaging Het
Cacna1c T C 6: 118,602,237 D1480G probably damaging Het
Clk3 A G 9: 57,752,166 M533T probably damaging Het
Cnbd1 A G 4: 18,860,504 I414T possibly damaging Het
Commd3 A T 2: 18,674,703 probably null Het
Crybg1 G T 10: 43,997,906 Q1069K probably damaging Het
Dnah8 T A 17: 30,765,711 F3128I probably damaging Het
Dnmt3b C T 2: 153,672,272 P382S probably benign Het
Dock1 A G 7: 134,777,495 probably null Het
Dpysl3 C T 18: 43,333,876 probably null Het
Ebf2 T A 14: 67,238,540 probably benign Het
F830045P16Rik T C 2: 129,463,704 E250G possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fetub T C 16: 22,929,086 probably benign Het
Fmn2 A T 1: 174,608,449 probably benign Het
Fryl T C 5: 73,022,278 I2929V probably benign Het
Gm11232 T A 4: 71,756,875 Q130L possibly damaging Het
Gm9637 G T 14: 19,402,570 noncoding transcript Het
Gna15 A G 10: 81,512,405 probably null Het
Gtf3c5 T C 2: 28,572,186 probably benign Het
Irs2 G A 8: 11,005,723 T903I possibly damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Izumo1 A G 7: 45,627,197 T395A probably benign Het
Kcnd2 G A 6: 21,727,226 V593M possibly damaging Het
Kprp T C 3: 92,824,682 S354G probably damaging Het
Krt72 T C 15: 101,786,008 K151E probably damaging Het
Letm2 A T 8: 25,587,448 probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mef2c A G 13: 83,652,873 N231D possibly damaging Het
Mtdh T A 15: 34,134,280 probably benign Het
Mthfd1 G A 12: 76,297,589 probably benign Het
Nbeal1 C A 1: 60,247,717 N899K probably benign Het
Noc3l T C 19: 38,814,809 S129G probably benign Het
Olfr1223 T C 2: 89,144,622 I134V possibly damaging Het
Olfr1338 T C 4: 118,753,903 I212V probably benign Het
Olfr171 T C 16: 19,624,417 M228V probably benign Het
Olfr905 T A 9: 38,473,258 D170E probably benign Het
Pik3r6 T A 11: 68,528,809 Y149N probably damaging Het
Pja2 C A 17: 64,308,971 V310L probably damaging Het
Plcd3 G A 11: 103,074,894 A504V probably benign Het
Rint1 G A 5: 23,787,828 probably benign Het
Ripor3 A G 2: 167,984,438 probably benign Het
Rpa2 C A 4: 132,777,814 N251K probably damaging Het
Rttn T C 18: 89,010,966 probably null Het
Ryr2 C T 13: 11,869,116 probably null Het
Scara3 T C 14: 65,930,968 N400S probably damaging Het
Slc7a6 G T 8: 106,189,631 V180L possibly damaging Het
Slc7a6 T A 8: 106,189,632 V180E probably damaging Het
Slc8b1 T A 5: 120,521,863 probably null Het
Slco1a4 G A 6: 141,819,479 Q346* probably null Het
Stk32b A G 5: 37,461,448 S229P probably damaging Het
Syde2 A G 3: 145,998,753 R487G probably benign Het
Tbc1d2b T C 9: 90,222,302 probably benign Het
Ticrr T C 7: 79,667,906 V396A probably benign Het
Trrap T C 5: 144,782,193 probably benign Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Wdr36 T G 18: 32,864,749 V820G possibly damaging Het
Wdr83 G A 8: 85,079,827 T114I possibly damaging Het
Zc3h7a T C 16: 11,139,147 N866S probably damaging Het
Zfc3h1 A G 10: 115,416,753 K1324E probably benign Het
Other mutations in Lipe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lipe APN 7 25383552 missense probably damaging 1.00
IGL00517:Lipe APN 7 25388560 unclassified probably null
IGL00817:Lipe APN 7 25388449 missense probably damaging 1.00
IGL01459:Lipe APN 7 25383542 missense probably damaging 1.00
IGL01946:Lipe APN 7 25383276 missense possibly damaging 0.90
IGL02931:Lipe APN 7 25383335 splice site probably benign
IGL02973:Lipe APN 7 25383632 missense probably damaging 0.98
IGL03091:Lipe APN 7 25380755 missense probably damaging 1.00
reservoir UTSW 7 25380143 missense probably damaging 1.00
3-1:Lipe UTSW 7 25397820 missense probably damaging 0.97
PIT4243001:Lipe UTSW 7 25395546 missense probably benign
R0062:Lipe UTSW 7 25398449 missense possibly damaging 0.46
R0432:Lipe UTSW 7 25398488 missense probably benign 0.00
R0528:Lipe UTSW 7 25398476 missense possibly damaging 0.92
R0534:Lipe UTSW 7 25388186 missense possibly damaging 0.66
R1487:Lipe UTSW 7 25384815 missense possibly damaging 0.47
R1502:Lipe UTSW 7 25398147 missense possibly damaging 0.66
R1606:Lipe UTSW 7 25388144 missense probably damaging 1.00
R1713:Lipe UTSW 7 25385325 missense probably damaging 0.99
R2147:Lipe UTSW 7 25388521 missense probably benign 0.01
R3031:Lipe UTSW 7 25384895 missense possibly damaging 0.65
R3110:Lipe UTSW 7 25398423 missense probably benign
R3112:Lipe UTSW 7 25398423 missense probably benign
R3792:Lipe UTSW 7 25397620 missense possibly damaging 0.82
R4453:Lipe UTSW 7 25397690 missense probably damaging 0.99
R4582:Lipe UTSW 7 25397702 missense probably benign
R4816:Lipe UTSW 7 25380143 missense probably damaging 1.00
R5639:Lipe UTSW 7 25383325 missense probably benign 0.00
R5653:Lipe UTSW 7 25398408 missense probably benign 0.08
R6322:Lipe UTSW 7 25380536 missense probably damaging 1.00
R6575:Lipe UTSW 7 25383324 missense probably benign 0.03
R7065:Lipe UTSW 7 25385178 critical splice donor site probably null
R7250:Lipe UTSW 7 25388660 start gained probably benign
R7485:Lipe UTSW 7 25380611 missense probably benign 0.01
R7636:Lipe UTSW 7 25388617 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AGATGGCTTCCTGTTGATCCAAGTG -3'
(R):5'- ATGCCAGGACAAAAGATTAGAGCCC -3'

Sequencing Primer
(F):5'- ATTTCTGAAGCAGAGCGGATTG -3'
(R):5'- CAAAGGGATGTGCCATCATGAAC -3'
Posted On2013-06-11