Incidental Mutation 'R0062:Ticrr'
ID 46621
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 038354-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R0062 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 79660196-79698148 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79667906 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 396 (V396A)
Ref Sequence ENSEMBL: ENSMUSP00000146221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably benign
Transcript: ENSMUST00000035977
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591

low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
AA Change: V396A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206072
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206677
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G T 10: 120,778,606 probably benign Het
4930407I10Rik T A 15: 82,063,066 I388K probably benign Het
4930407I10Rik T A 15: 82,066,303 V1467D probably damaging Het
Abi2 T A 1: 60,453,725 N182K probably benign Het
Adam25 A T 8: 40,754,792 H365L probably damaging Het
Ankfy1 T A 11: 72,712,204 Y20N probably damaging Het
Aqp11 C T 7: 97,737,861 V43M probably benign Het
Arhgef10l A T 4: 140,552,532 L503Q probably damaging Het
Arhgef28 A T 13: 97,956,642 I977N possibly damaging Het
Armc4 T A 18: 7,129,593 probably benign Het
Cacna1b A G 2: 24,758,331 Y161H probably damaging Het
Cacna1c T C 6: 118,602,237 D1480G probably damaging Het
Clk3 A G 9: 57,752,166 M533T probably damaging Het
Cnbd1 A G 4: 18,860,504 I414T possibly damaging Het
Commd3 A T 2: 18,674,703 probably null Het
Crybg1 G T 10: 43,997,906 Q1069K probably damaging Het
Dnah8 T A 17: 30,765,711 F3128I probably damaging Het
Dnmt3b C T 2: 153,672,272 P382S probably benign Het
Dock1 A G 7: 134,777,495 probably null Het
Dpysl3 C T 18: 43,333,876 probably null Het
Ebf2 T A 14: 67,238,540 probably benign Het
F830045P16Rik T C 2: 129,463,704 E250G possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fetub T C 16: 22,929,086 probably benign Het
Fmn2 A T 1: 174,608,449 probably benign Het
Fryl T C 5: 73,022,278 I2929V probably benign Het
Gm11232 T A 4: 71,756,875 Q130L possibly damaging Het
Gm9637 G T 14: 19,402,570 noncoding transcript Het
Gna15 A G 10: 81,512,405 probably null Het
Gtf3c5 T C 2: 28,572,186 probably benign Het
Irs2 G A 8: 11,005,723 T903I possibly damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Izumo1 A G 7: 45,627,197 T395A probably benign Het
Kcnd2 G A 6: 21,727,226 V593M possibly damaging Het
Kprp T C 3: 92,824,682 S354G probably damaging Het
Krt72 T C 15: 101,786,008 K151E probably damaging Het
Letm2 A T 8: 25,587,448 probably benign Het
Lipe A G 7: 25,398,449 V23A possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Mef2c A G 13: 83,652,873 N231D possibly damaging Het
Mtdh T A 15: 34,134,280 probably benign Het
Mthfd1 G A 12: 76,297,589 probably benign Het
Nbeal1 C A 1: 60,247,717 N899K probably benign Het
Noc3l T C 19: 38,814,809 S129G probably benign Het
Olfr1223 T C 2: 89,144,622 I134V possibly damaging Het
Olfr1338 T C 4: 118,753,903 I212V probably benign Het
Olfr171 T C 16: 19,624,417 M228V probably benign Het
Olfr905 T A 9: 38,473,258 D170E probably benign Het
Pik3r6 T A 11: 68,528,809 Y149N probably damaging Het
Pja2 C A 17: 64,308,971 V310L probably damaging Het
Plcd3 G A 11: 103,074,894 A504V probably benign Het
Rint1 G A 5: 23,787,828 probably benign Het
Ripor3 A G 2: 167,984,438 probably benign Het
Rpa2 C A 4: 132,777,814 N251K probably damaging Het
Rttn T C 18: 89,010,966 probably null Het
Ryr2 C T 13: 11,869,116 probably null Het
Scara3 T C 14: 65,930,968 N400S probably damaging Het
Slc7a6 G T 8: 106,189,631 V180L possibly damaging Het
Slc7a6 T A 8: 106,189,632 V180E probably damaging Het
Slc8b1 T A 5: 120,521,863 probably null Het
Slco1a4 G A 6: 141,819,479 Q346* probably null Het
Stk32b A G 5: 37,461,448 S229P probably damaging Het
Syde2 A G 3: 145,998,753 R487G probably benign Het
Tbc1d2b T C 9: 90,222,302 probably benign Het
Trrap T C 5: 144,782,193 probably benign Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Wdr36 T G 18: 32,864,749 V820G possibly damaging Het
Wdr83 G A 8: 85,079,827 T114I possibly damaging Het
Zc3h7a T C 16: 11,139,147 N866S probably damaging Het
Zfc3h1 A G 10: 115,416,753 K1324E probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
PIT4305001:Ticrr UTSW 7 79679023 missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79669638 missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 splice site probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79693742 missense probably damaging 0.96
R7285:Ticrr UTSW 7 79660862 missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79691849 missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79693986 missense probably benign
R7583:Ticrr UTSW 7 79696739 nonsense probably null
R7749:Ticrr UTSW 7 79679096 missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79682012 missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79669485 missense probably benign 0.23
R7935:Ticrr UTSW 7 79681836 missense probably damaging 0.99
R8005:Ticrr UTSW 7 79694048 missense probably damaging 0.98
R8080:Ticrr UTSW 7 79684264 splice site probably null
R8181:Ticrr UTSW 7 79660980 missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79694680 missense probably benign 0.27
R8410:Ticrr UTSW 7 79667675 missense probably damaging 0.98
R8449:Ticrr UTSW 7 79694680 missense probably benign 0.27
R9073:Ticrr UTSW 7 79667931 missense probably benign 0.01
R9090:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79693768 missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79680987 missense probably damaging 0.99
R9469:Ticrr UTSW 7 79694763 missense probably benign 0.03
R9502:Ticrr UTSW 7 79693849 missense probably benign
R9614:Ticrr UTSW 7 79696006 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gaagagggcatcagatttcattac -3'
Posted On 2013-06-11