Incidental Mutation 'R0062:Ticrr'
ID 46621
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 038354-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R0062 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79317654 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 396 (V396A)
Ref Sequence ENSEMBL: ENSMUSP00000146221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably benign
Transcript: ENSMUST00000035977
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
AA Change: V396A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206072
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206677
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G T 10: 120,614,511 (GRCm39) probably benign Het
4930407I10Rik T A 15: 81,947,267 (GRCm39) I388K probably benign Het
4930407I10Rik T A 15: 81,950,504 (GRCm39) V1467D probably damaging Het
Abi2 T A 1: 60,492,884 (GRCm39) N182K probably benign Het
Adam25 A T 8: 41,207,829 (GRCm39) H365L probably damaging Het
Ankfy1 T A 11: 72,603,030 (GRCm39) Y20N probably damaging Het
Aqp11 C T 7: 97,387,068 (GRCm39) V43M probably benign Het
Arhgef10l A T 4: 140,279,843 (GRCm39) L503Q probably damaging Het
Arhgef28 A T 13: 98,093,150 (GRCm39) I977N possibly damaging Het
Cacna1b A G 2: 24,648,343 (GRCm39) Y161H probably damaging Het
Cacna1c T C 6: 118,579,198 (GRCm39) D1480G probably damaging Het
Clk3 A G 9: 57,659,449 (GRCm39) M533T probably damaging Het
Cnbd1 A G 4: 18,860,504 (GRCm39) I414T possibly damaging Het
Commd3 A T 2: 18,679,514 (GRCm39) probably null Het
Crybg1 G T 10: 43,873,902 (GRCm39) Q1069K probably damaging Het
Dnah8 T A 17: 30,984,685 (GRCm39) F3128I probably damaging Het
Dnmt3b C T 2: 153,514,192 (GRCm39) P382S probably benign Het
Dock1 A G 7: 134,379,224 (GRCm39) probably null Het
Dpysl3 C T 18: 43,466,941 (GRCm39) probably null Het
Ebf2 T A 14: 67,475,989 (GRCm39) probably benign Het
F830045P16Rik T C 2: 129,305,624 (GRCm39) E250G possibly damaging Het
Fbp2 A T 13: 63,001,862 (GRCm39) F118I probably damaging Het
Fetub T C 16: 22,747,836 (GRCm39) probably benign Het
Fmn2 A T 1: 174,436,015 (GRCm39) probably benign Het
Fryl T C 5: 73,179,621 (GRCm39) I2929V probably benign Het
Gm11232 T A 4: 71,675,112 (GRCm39) Q130L possibly damaging Het
Gm9637 G T 14: 19,402,570 (GRCm38) noncoding transcript Het
Gna15 A G 10: 81,348,239 (GRCm39) probably null Het
Gtf3c5 T C 2: 28,462,198 (GRCm39) probably benign Het
Irs2 G A 8: 11,055,723 (GRCm39) T903I possibly damaging Het
Itga2 G A 13: 115,007,032 (GRCm39) S432L possibly damaging Het
Izumo1 A G 7: 45,276,621 (GRCm39) T395A probably benign Het
Kcnd2 G A 6: 21,727,225 (GRCm39) V593M possibly damaging Het
Kprp T C 3: 92,731,989 (GRCm39) S354G probably damaging Het
Krt72 T C 15: 101,694,443 (GRCm39) K151E probably damaging Het
Letm2 A T 8: 26,077,464 (GRCm39) probably benign Het
Lipe A G 7: 25,097,874 (GRCm39) V23A possibly damaging Het
Mcc C G 18: 44,652,583 (GRCm39) probably benign Het
Mef2c A G 13: 83,800,992 (GRCm39) N231D possibly damaging Het
Mtdh T A 15: 34,134,426 (GRCm39) probably benign Het
Mthfd1 G A 12: 76,344,363 (GRCm39) probably benign Het
Nbeal1 C A 1: 60,286,876 (GRCm39) N899K probably benign Het
Noc3l T C 19: 38,803,253 (GRCm39) S129G probably benign Het
Odad2 T A 18: 7,129,593 (GRCm39) probably benign Het
Or10ak14 T C 4: 118,611,100 (GRCm39) I212V probably benign Het
Or2aj6 T C 16: 19,443,167 (GRCm39) M228V probably benign Het
Or4c118 T C 2: 88,974,966 (GRCm39) I134V possibly damaging Het
Or8b1c T A 9: 38,384,554 (GRCm39) D170E probably benign Het
Pik3r6 T A 11: 68,419,635 (GRCm39) Y149N probably damaging Het
Pja2 C A 17: 64,615,966 (GRCm39) V310L probably damaging Het
Plcd3 G A 11: 102,965,720 (GRCm39) A504V probably benign Het
Rint1 G A 5: 23,992,826 (GRCm39) probably benign Het
Ripor3 A G 2: 167,826,358 (GRCm39) probably benign Het
Rpa2 C A 4: 132,505,125 (GRCm39) N251K probably damaging Het
Rttn T C 18: 89,029,090 (GRCm39) probably null Het
Ryr2 C T 13: 11,884,002 (GRCm39) probably null Het
Scara3 T C 14: 66,168,417 (GRCm39) N400S probably damaging Het
Slc7a6 G T 8: 106,916,263 (GRCm39) V180L possibly damaging Het
Slc7a6 T A 8: 106,916,264 (GRCm39) V180E probably damaging Het
Slc8b1 T A 5: 120,659,928 (GRCm39) probably null Het
Slco1a4 G A 6: 141,765,205 (GRCm39) Q346* probably null Het
Stk32b A G 5: 37,618,792 (GRCm39) S229P probably damaging Het
Syde2 A G 3: 145,704,508 (GRCm39) R487G probably benign Het
Tbc1d2b T C 9: 90,104,355 (GRCm39) probably benign Het
Trrap T C 5: 144,719,003 (GRCm39) probably benign Het
Vmn1r124 A T 7: 20,993,743 (GRCm39) I267K probably benign Het
Vps13a A T 19: 16,646,054 (GRCm39) H1994Q probably damaging Het
Wdr36 T G 18: 32,997,802 (GRCm39) V820G possibly damaging Het
Wdr83 G A 8: 85,806,456 (GRCm39) T114I possibly damaging Het
Zc3h7a T C 16: 10,957,011 (GRCm39) N866S probably damaging Het
Zfc3h1 A G 10: 115,252,658 (GRCm39) K1324E probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGCCTTTAGCCATGCATCAGAGAC -3'
(R):5'- AGTGAGAAACCACCCATCATTTCAGTC -3'

Sequencing Primer
(F):5'- GCCATGCATCAGAGACATTTTC -3'
(R):5'- gaagagggcatcagatttcattac -3'
Posted On 2013-06-11