Incidental Mutation 'R0062:Dock1'
ID46623
Institutional Source Beutler Lab
Gene Symbol Dock1
Ensembl Gene ENSMUSG00000058325
Gene Namededicator of cytokinesis 1
SynonymsD630004B07Rik, Dock180, 9130006G06Rik
MMRRC Submission 038354-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0062 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location134670654-135173639 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 134777495 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084488] [ENSMUST00000084488] [ENSMUST00000211593] [ENSMUST00000211593]
Predicted Effect probably null
Transcript: ENSMUST00000084488
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000084488
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000210121
Predicted Effect probably null
Transcript: ENSMUST00000210121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211570
Predicted Effect probably null
Transcript: ENSMUST00000211593
Predicted Effect probably null
Transcript: ENSMUST00000211593
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Dedicator of cytokinesis proteins act as guanine nucleotide exchange factors for small Rho family G proteins. The encoded protein regulates the small GTPase Rac, thereby influencing several biological processes, including phagocytosis and cell migration. Overexpression of this gene has also been associated with certain cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G T 10: 120,778,606 probably benign Het
4930407I10Rik T A 15: 82,063,066 I388K probably benign Het
4930407I10Rik T A 15: 82,066,303 V1467D probably damaging Het
Abi2 T A 1: 60,453,725 N182K probably benign Het
Adam25 A T 8: 40,754,792 H365L probably damaging Het
Ankfy1 T A 11: 72,712,204 Y20N probably damaging Het
Aqp11 C T 7: 97,737,861 V43M probably benign Het
Arhgef10l A T 4: 140,552,532 L503Q probably damaging Het
Arhgef28 A T 13: 97,956,642 I977N possibly damaging Het
Armc4 T A 18: 7,129,593 probably benign Het
Cacna1b A G 2: 24,758,331 Y161H probably damaging Het
Cacna1c T C 6: 118,602,237 D1480G probably damaging Het
Clk3 A G 9: 57,752,166 M533T probably damaging Het
Cnbd1 A G 4: 18,860,504 I414T possibly damaging Het
Commd3 A T 2: 18,674,703 probably null Het
Crybg1 G T 10: 43,997,906 Q1069K probably damaging Het
Dnah8 T A 17: 30,765,711 F3128I probably damaging Het
Dnmt3b C T 2: 153,672,272 P382S probably benign Het
Dpysl3 C T 18: 43,333,876 probably null Het
Ebf2 T A 14: 67,238,540 probably benign Het
F830045P16Rik T C 2: 129,463,704 E250G possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fetub T C 16: 22,929,086 probably benign Het
Fmn2 A T 1: 174,608,449 probably benign Het
Fryl T C 5: 73,022,278 I2929V probably benign Het
Gm11232 T A 4: 71,756,875 Q130L possibly damaging Het
Gm9637 G T 14: 19,402,570 noncoding transcript Het
Gna15 A G 10: 81,512,405 probably null Het
Gtf3c5 T C 2: 28,572,186 probably benign Het
Irs2 G A 8: 11,005,723 T903I possibly damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Izumo1 A G 7: 45,627,197 T395A probably benign Het
Kcnd2 G A 6: 21,727,226 V593M possibly damaging Het
Kprp T C 3: 92,824,682 S354G probably damaging Het
Krt72 T C 15: 101,786,008 K151E probably damaging Het
Letm2 A T 8: 25,587,448 probably benign Het
Lipe A G 7: 25,398,449 V23A possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Mef2c A G 13: 83,652,873 N231D possibly damaging Het
Mtdh T A 15: 34,134,280 probably benign Het
Mthfd1 G A 12: 76,297,589 probably benign Het
Nbeal1 C A 1: 60,247,717 N899K probably benign Het
Noc3l T C 19: 38,814,809 S129G probably benign Het
Olfr1223 T C 2: 89,144,622 I134V possibly damaging Het
Olfr1338 T C 4: 118,753,903 I212V probably benign Het
Olfr171 T C 16: 19,624,417 M228V probably benign Het
Olfr905 T A 9: 38,473,258 D170E probably benign Het
Pik3r6 T A 11: 68,528,809 Y149N probably damaging Het
Pja2 C A 17: 64,308,971 V310L probably damaging Het
Plcd3 G A 11: 103,074,894 A504V probably benign Het
Rint1 G A 5: 23,787,828 probably benign Het
Ripor3 A G 2: 167,984,438 probably benign Het
Rpa2 C A 4: 132,777,814 N251K probably damaging Het
Rttn T C 18: 89,010,966 probably null Het
Ryr2 C T 13: 11,869,116 probably null Het
Scara3 T C 14: 65,930,968 N400S probably damaging Het
Slc7a6 G T 8: 106,189,631 V180L possibly damaging Het
Slc7a6 T A 8: 106,189,632 V180E probably damaging Het
Slc8b1 T A 5: 120,521,863 probably null Het
Slco1a4 G A 6: 141,819,479 Q346* probably null Het
Stk32b A G 5: 37,461,448 S229P probably damaging Het
Syde2 A G 3: 145,998,753 R487G probably benign Het
Tbc1d2b T C 9: 90,222,302 probably benign Het
Ticrr T C 7: 79,667,906 V396A probably benign Het
Trrap T C 5: 144,782,193 probably benign Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Wdr36 T G 18: 32,864,749 V820G possibly damaging Het
Wdr83 G A 8: 85,079,827 T114I possibly damaging Het
Zc3h7a T C 16: 11,139,147 N866S probably damaging Het
Zfc3h1 A G 10: 115,416,753 K1324E probably benign Het
Other mutations in Dock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Dock1 APN 7 135146531 splice site probably benign
IGL01319:Dock1 APN 7 134789278 missense probably benign
IGL01390:Dock1 APN 7 134745047 missense possibly damaging 0.95
IGL01394:Dock1 APN 7 134766216 missense probably benign 0.01
IGL01489:Dock1 APN 7 134999321 splice site probably benign
IGL01505:Dock1 APN 7 135158510 missense possibly damaging 0.91
IGL01586:Dock1 APN 7 134753377 missense probably damaging 1.00
IGL01637:Dock1 APN 7 135137813 critical splice acceptor site probably null
IGL01649:Dock1 APN 7 134777410 missense probably damaging 1.00
IGL01652:Dock1 APN 7 134777497 splice site probably benign
IGL01859:Dock1 APN 7 135077161 missense possibly damaging 0.51
IGL02068:Dock1 APN 7 134771548 missense probably benign 0.26
IGL02168:Dock1 APN 7 135077131 splice site probably benign
IGL02200:Dock1 APN 7 134744271 missense probably benign 0.01
IGL02244:Dock1 APN 7 134777445 nonsense probably null
IGL02285:Dock1 APN 7 135081920 critical splice donor site probably null
IGL02319:Dock1 APN 7 134772449 missense possibly damaging 0.94
IGL02334:Dock1 APN 7 135145565 missense probably damaging 1.00
IGL02338:Dock1 APN 7 135133075 missense possibly damaging 0.95
IGL02351:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02358:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02607:Dock1 APN 7 134851513 missense probably benign 0.13
IGL02638:Dock1 APN 7 135146480 missense probably benign 0.09
IGL02724:Dock1 APN 7 135163353 missense probably benign
IGL02820:Dock1 APN 7 135167215 missense probably benign 0.11
IGL02950:Dock1 APN 7 134730024 missense probably damaging 1.00
IGL02993:Dock1 APN 7 134744298 missense probably benign
IGL03000:Dock1 APN 7 134789240 missense probably benign 0.17
IGL03092:Dock1 APN 7 134765216 splice site probably benign
IGL03131:Dock1 APN 7 134874183 missense possibly damaging 0.80
IGL03136:Dock1 APN 7 135168389 missense probably benign 0.00
IGL03210:Dock1 APN 7 134756939 missense possibly damaging 0.62
IGL03220:Dock1 APN 7 135108522 critical splice donor site probably null
P0028:Dock1 UTSW 7 134999324 splice site probably benign
PIT4453001:Dock1 UTSW 7 135152300 missense probably benign
R0003:Dock1 UTSW 7 134730064 splice site probably benign
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0179:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0180:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0347:Dock1 UTSW 7 134763867 missense probably damaging 1.00
R0399:Dock1 UTSW 7 135163442 missense probably benign 0.00
R0457:Dock1 UTSW 7 135138145 missense possibly damaging 0.90
R0480:Dock1 UTSW 7 134737718 missense probably damaging 1.00
R0521:Dock1 UTSW 7 135143778 missense probably benign 0.21
R0792:Dock1 UTSW 7 134874150 missense probably benign 0.02
R1136:Dock1 UTSW 7 134848173 missense possibly damaging 0.95
R1224:Dock1 UTSW 7 135108819 missense possibly damaging 0.67
R1267:Dock1 UTSW 7 134746436 missense probably damaging 1.00
R1373:Dock1 UTSW 7 135167175 missense probably benign 0.01
R1401:Dock1 UTSW 7 135133936 nonsense probably null
R1454:Dock1 UTSW 7 134851609 splice site probably benign
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1523:Dock1 UTSW 7 134744247 missense possibly damaging 0.49
R1643:Dock1 UTSW 7 135098779 missense probably damaging 1.00
R1659:Dock1 UTSW 7 134789243 missense probably damaging 0.98
R1793:Dock1 UTSW 7 135098727 splice site probably null
R1864:Dock1 UTSW 7 135146507 missense probably benign 0.07
R1911:Dock1 UTSW 7 134999300 missense probably damaging 1.00
R2567:Dock1 UTSW 7 135145484 missense probably damaging 1.00
R3816:Dock1 UTSW 7 134744286 nonsense probably null
R3971:Dock1 UTSW 7 134746908 missense probably damaging 1.00
R4063:Dock1 UTSW 7 135115292 missense possibly damaging 0.81
R4163:Dock1 UTSW 7 134744322 missense possibly damaging 0.79
R4271:Dock1 UTSW 7 134734054 missense probably damaging 0.99
R4684:Dock1 UTSW 7 134724409 nonsense probably null
R4717:Dock1 UTSW 7 134848170 missense probably damaging 1.00
R4725:Dock1 UTSW 7 134745014 nonsense probably null
R4788:Dock1 UTSW 7 135145484 missense probably damaging 0.98
R4869:Dock1 UTSW 7 134734071 missense probably damaging 1.00
R4889:Dock1 UTSW 7 134744976 missense probably benign 0.02
R4953:Dock1 UTSW 7 135152288 missense probably benign 0.34
R5031:Dock1 UTSW 7 135152246 missense probably benign 0.02
R5161:Dock1 UTSW 7 134734062 missense possibly damaging 0.69
R5168:Dock1 UTSW 7 135118908 missense probably damaging 1.00
R5212:Dock1 UTSW 7 134789194 missense possibly damaging 0.68
R5648:Dock1 UTSW 7 134746954 missense probably damaging 1.00
R5685:Dock1 UTSW 7 134772362 missense probably benign 0.19
R5834:Dock1 UTSW 7 134763933 missense probably damaging 1.00
R6181:Dock1 UTSW 7 135158522 missense probably damaging 1.00
R6334:Dock1 UTSW 7 134851576 missense probably benign 0.01
R6406:Dock1 UTSW 7 135145486 missense probably benign 0.26
R6425:Dock1 UTSW 7 135163381 missense possibly damaging 0.79
R6489:Dock1 UTSW 7 134990541 missense probably damaging 0.99
R6616:Dock1 UTSW 7 135108492 missense possibly damaging 0.85
R6706:Dock1 UTSW 7 135133886 missense possibly damaging 0.72
R6766:Dock1 UTSW 7 134756793 splice site probably null
R6861:Dock1 UTSW 7 134771478 missense probably benign 0.00
R6985:Dock1 UTSW 7 135163403 missense possibly damaging 0.95
R7259:Dock1 UTSW 7 134782748 missense probably damaging 0.99
R7285:Dock1 UTSW 7 134745008 missense probably benign 0.01
R7471:Dock1 UTSW 7 135163343 missense possibly damaging 0.65
R7497:Dock1 UTSW 7 134765274 missense probably benign
R7691:Dock1 UTSW 7 135138157 critical splice donor site probably null
R7732:Dock1 UTSW 7 134744970 missense probably benign 0.01
R7818:Dock1 UTSW 7 134763865 missense probably damaging 1.00
R7918:Dock1 UTSW 7 135145418 missense probably damaging 1.00
R7960:Dock1 UTSW 7 135077188 missense possibly damaging 0.83
R7961:Dock1 UTSW 7 134745057 missense possibly damaging 0.77
R7985:Dock1 UTSW 7 134746954 missense possibly damaging 0.95
R8009:Dock1 UTSW 7 134745057 missense possibly damaging 0.77
R8060:Dock1 UTSW 7 135168403 missense probably benign
R8060:Dock1 UTSW 7 134990629 splice site probably benign
R8061:Dock1 UTSW 7 134772323 missense probably benign 0.00
R8101:Dock1 UTSW 7 134999288 missense possibly damaging 0.89
R8405:Dock1 UTSW 7 134777463 missense probably benign 0.04
R8508:Dock1 UTSW 7 134782409 missense probably benign 0.00
X0062:Dock1 UTSW 7 135108451 missense probably damaging 1.00
Z1088:Dock1 UTSW 7 134804547 missense probably damaging 0.98
Z1177:Dock1 UTSW 7 134782400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTTGTTCTTGAGCATGACGAGCC -3'
(R):5'- CCTTCCAAAGAGAGTTCAGCAGCAC -3'

Sequencing Primer
(F):5'- CTTGAGCATGACGAGCCATTTG -3'
(R):5'- ATAACCAGAACCTGGCACTTCC -3'
Posted On2013-06-11