Incidental Mutation 'R0062:Slc7a6'
ID46629
Institutional Source Beutler Lab
Gene Symbol Slc7a6
Ensembl Gene ENSMUSG00000031904
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 6
SynonymsLAT-2
MMRRC Submission 038354-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R0062 (G1)
Quality Score190
Status Validated
Chromosome8
Chromosomal Location106168857-106198706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106189632 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 180 (V180E)
Ref Sequence ENSEMBL: ENSMUSP00000034378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034378] [ENSMUST00000211824] [ENSMUST00000212377] [ENSMUST00000212421]
Predicted Effect probably damaging
Transcript: ENSMUST00000034378
AA Change: V180E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034378
Gene: ENSMUSG00000031904
AA Change: V180E

DomainStartEndE-ValueType
Pfam:AA_permease_2 45 467 1.2e-66 PFAM
Pfam:AA_permease 50 471 2.1e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211824
AA Change: V180E

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000212377
Predicted Effect probably benign
Transcript: ENSMUST00000212421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213020
Meta Mutation Damage Score 0.7245 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G T 10: 120,778,606 probably benign Het
4930407I10Rik T A 15: 82,063,066 I388K probably benign Het
4930407I10Rik T A 15: 82,066,303 V1467D probably damaging Het
Abi2 T A 1: 60,453,725 N182K probably benign Het
Adam25 A T 8: 40,754,792 H365L probably damaging Het
Ankfy1 T A 11: 72,712,204 Y20N probably damaging Het
Aqp11 C T 7: 97,737,861 V43M probably benign Het
Arhgef10l A T 4: 140,552,532 L503Q probably damaging Het
Arhgef28 A T 13: 97,956,642 I977N possibly damaging Het
Armc4 T A 18: 7,129,593 probably benign Het
Cacna1b A G 2: 24,758,331 Y161H probably damaging Het
Cacna1c T C 6: 118,602,237 D1480G probably damaging Het
Clk3 A G 9: 57,752,166 M533T probably damaging Het
Cnbd1 A G 4: 18,860,504 I414T possibly damaging Het
Commd3 A T 2: 18,674,703 probably null Het
Crybg1 G T 10: 43,997,906 Q1069K probably damaging Het
Dnah8 T A 17: 30,765,711 F3128I probably damaging Het
Dnmt3b C T 2: 153,672,272 P382S probably benign Het
Dock1 A G 7: 134,777,495 probably null Het
Dpysl3 C T 18: 43,333,876 probably null Het
Ebf2 T A 14: 67,238,540 probably benign Het
F830045P16Rik T C 2: 129,463,704 E250G possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fetub T C 16: 22,929,086 probably benign Het
Fmn2 A T 1: 174,608,449 probably benign Het
Fryl T C 5: 73,022,278 I2929V probably benign Het
Gm11232 T A 4: 71,756,875 Q130L possibly damaging Het
Gm9637 G T 14: 19,402,570 noncoding transcript Het
Gna15 A G 10: 81,512,405 probably null Het
Gtf3c5 T C 2: 28,572,186 probably benign Het
Irs2 G A 8: 11,005,723 T903I possibly damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Izumo1 A G 7: 45,627,197 T395A probably benign Het
Kcnd2 G A 6: 21,727,226 V593M possibly damaging Het
Kprp T C 3: 92,824,682 S354G probably damaging Het
Krt72 T C 15: 101,786,008 K151E probably damaging Het
Letm2 A T 8: 25,587,448 probably benign Het
Lipe A G 7: 25,398,449 V23A possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Mef2c A G 13: 83,652,873 N231D possibly damaging Het
Mtdh T A 15: 34,134,280 probably benign Het
Mthfd1 G A 12: 76,297,589 probably benign Het
Nbeal1 C A 1: 60,247,717 N899K probably benign Het
Noc3l T C 19: 38,814,809 S129G probably benign Het
Olfr1223 T C 2: 89,144,622 I134V possibly damaging Het
Olfr1338 T C 4: 118,753,903 I212V probably benign Het
Olfr171 T C 16: 19,624,417 M228V probably benign Het
Olfr905 T A 9: 38,473,258 D170E probably benign Het
Pik3r6 T A 11: 68,528,809 Y149N probably damaging Het
Pja2 C A 17: 64,308,971 V310L probably damaging Het
Plcd3 G A 11: 103,074,894 A504V probably benign Het
Rint1 G A 5: 23,787,828 probably benign Het
Ripor3 A G 2: 167,984,438 probably benign Het
Rpa2 C A 4: 132,777,814 N251K probably damaging Het
Rttn T C 18: 89,010,966 probably null Het
Ryr2 C T 13: 11,869,116 probably null Het
Scara3 T C 14: 65,930,968 N400S probably damaging Het
Slc8b1 T A 5: 120,521,863 probably null Het
Slco1a4 G A 6: 141,819,479 Q346* probably null Het
Stk32b A G 5: 37,461,448 S229P probably damaging Het
Syde2 A G 3: 145,998,753 R487G probably benign Het
Tbc1d2b T C 9: 90,222,302 probably benign Het
Ticrr T C 7: 79,667,906 V396A probably benign Het
Trrap T C 5: 144,782,193 probably benign Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Wdr36 T G 18: 32,864,749 V820G possibly damaging Het
Wdr83 G A 8: 85,079,827 T114I possibly damaging Het
Zc3h7a T C 16: 11,139,147 N866S probably damaging Het
Zfc3h1 A G 10: 115,416,753 K1324E probably benign Het
Other mutations in Slc7a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Slc7a6 APN 8 106179240 missense probably benign 0.01
IGL01149:Slc7a6 APN 8 106179600 missense probably damaging 0.96
IGL02232:Slc7a6 APN 8 106196574 missense possibly damaging 0.87
IGL02972:Slc7a6 APN 8 106179427 missense probably damaging 0.99
IGL03082:Slc7a6 APN 8 106193222 unclassified probably null
IGL03108:Slc7a6 APN 8 106194517 missense probably damaging 0.99
R0062:Slc7a6 UTSW 8 106189631 missense possibly damaging 0.79
R0325:Slc7a6 UTSW 8 106194517 missense probably damaging 0.99
R1803:Slc7a6 UTSW 8 106192456 missense possibly damaging 0.70
R1928:Slc7a6 UTSW 8 106193488 unclassified probably benign
R5912:Slc7a6 UTSW 8 106179657 missense probably benign
R6317:Slc7a6 UTSW 8 106192467 missense probably damaging 0.98
R6370:Slc7a6 UTSW 8 106195437 missense probably benign 0.44
R7030:Slc7a6 UTSW 8 106195974 missense possibly damaging 0.64
R7944:Slc7a6 UTSW 8 106179607 missense possibly damaging 0.65
R7945:Slc7a6 UTSW 8 106179607 missense possibly damaging 0.65
R8369:Slc7a6 UTSW 8 106193164 missense probably damaging 0.99
R8397:Slc7a6 UTSW 8 106193533 missense probably damaging 1.00
RF008:Slc7a6 UTSW 8 106195398 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCCCTAGTAGCTTAGGATGCAGTG -3'
(R):5'- GCTGAAAGATGAAGCTGAGTCCCC -3'

Sequencing Primer
(F):5'- ATGCAGTGTAGGGTATTCATACG -3'
(R):5'- TGAAGCTGAGTCCCCACATC -3'
Posted On2013-06-11