Incidental Mutation 'R0062:Plcd3'
ID46640
Institutional Source Beutler Lab
Gene Symbol Plcd3
Ensembl Gene ENSMUSG00000020937
Gene Namephospholipase C, delta 3
Synonyms2610205J15Rik
MMRRC Submission 038354-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R0062 (G1)
Quality Score151
Status Validated
Chromosome11
Chromosomal Location103070304-103101658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103074894 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 504 (A504V)
Ref Sequence ENSEMBL: ENSMUSP00000099366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103077]
Predicted Effect probably benign
Transcript: ENSMUST00000103077
AA Change: A504V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099366
Gene: ENSMUSG00000020937
AA Change: A504V

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 23 38 N/A INTRINSIC
PH 61 170 4.07e-5 SMART
Pfam:EF-hand_10 197 246 1.8e-27 PFAM
Pfam:EF-hand_like 251 332 2.6e-24 PFAM
PLCXc 333 478 7.75e-85 SMART
low complexity region 495 512 N/A INTRINSIC
PLCYc 524 640 3.96e-50 SMART
C2 657 763 1.05e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124740
Predicted Effect unknown
Transcript: ENSMUST00000128650
AA Change: A189V
SMART Domains Protein: ENSMUSP00000117455
Gene: ENSMUSG00000020937
AA Change: A189V

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
PLCXc 19 164 7.75e-85 SMART
coiled coil region 172 206 N/A INTRINSIC
PLCYc 210 326 3.96e-50 SMART
C2 343 449 1.05e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family, which catalyze the hydrolysis of phosphatidylinositol 4,5-bisphosphate to generate the second messengers diacylglycerol and inositol 1,4,5-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine, sphingosine, and several phospholipids. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G T 10: 120,778,606 probably benign Het
4930407I10Rik T A 15: 82,063,066 I388K probably benign Het
4930407I10Rik T A 15: 82,066,303 V1467D probably damaging Het
Abi2 T A 1: 60,453,725 N182K probably benign Het
Adam25 A T 8: 40,754,792 H365L probably damaging Het
Ankfy1 T A 11: 72,712,204 Y20N probably damaging Het
Aqp11 C T 7: 97,737,861 V43M probably benign Het
Arhgef10l A T 4: 140,552,532 L503Q probably damaging Het
Arhgef28 A T 13: 97,956,642 I977N possibly damaging Het
Armc4 T A 18: 7,129,593 probably benign Het
Cacna1b A G 2: 24,758,331 Y161H probably damaging Het
Cacna1c T C 6: 118,602,237 D1480G probably damaging Het
Clk3 A G 9: 57,752,166 M533T probably damaging Het
Cnbd1 A G 4: 18,860,504 I414T possibly damaging Het
Commd3 A T 2: 18,674,703 probably null Het
Crybg1 G T 10: 43,997,906 Q1069K probably damaging Het
Dnah8 T A 17: 30,765,711 F3128I probably damaging Het
Dnmt3b C T 2: 153,672,272 P382S probably benign Het
Dock1 A G 7: 134,777,495 probably null Het
Dpysl3 C T 18: 43,333,876 probably null Het
Ebf2 T A 14: 67,238,540 probably benign Het
F830045P16Rik T C 2: 129,463,704 E250G possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fetub T C 16: 22,929,086 probably benign Het
Fmn2 A T 1: 174,608,449 probably benign Het
Fryl T C 5: 73,022,278 I2929V probably benign Het
Gm11232 T A 4: 71,756,875 Q130L possibly damaging Het
Gm9637 G T 14: 19,402,570 noncoding transcript Het
Gna15 A G 10: 81,512,405 probably null Het
Gtf3c5 T C 2: 28,572,186 probably benign Het
Irs2 G A 8: 11,005,723 T903I possibly damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Izumo1 A G 7: 45,627,197 T395A probably benign Het
Kcnd2 G A 6: 21,727,226 V593M possibly damaging Het
Kprp T C 3: 92,824,682 S354G probably damaging Het
Krt72 T C 15: 101,786,008 K151E probably damaging Het
Letm2 A T 8: 25,587,448 probably benign Het
Lipe A G 7: 25,398,449 V23A possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Mef2c A G 13: 83,652,873 N231D possibly damaging Het
Mtdh T A 15: 34,134,280 probably benign Het
Mthfd1 G A 12: 76,297,589 probably benign Het
Nbeal1 C A 1: 60,247,717 N899K probably benign Het
Noc3l T C 19: 38,814,809 S129G probably benign Het
Olfr1223 T C 2: 89,144,622 I134V possibly damaging Het
Olfr1338 T C 4: 118,753,903 I212V probably benign Het
Olfr171 T C 16: 19,624,417 M228V probably benign Het
Olfr905 T A 9: 38,473,258 D170E probably benign Het
Pik3r6 T A 11: 68,528,809 Y149N probably damaging Het
Pja2 C A 17: 64,308,971 V310L probably damaging Het
Rint1 G A 5: 23,787,828 probably benign Het
Ripor3 A G 2: 167,984,438 probably benign Het
Rpa2 C A 4: 132,777,814 N251K probably damaging Het
Rttn T C 18: 89,010,966 probably null Het
Ryr2 C T 13: 11,869,116 probably null Het
Scara3 T C 14: 65,930,968 N400S probably damaging Het
Slc7a6 G T 8: 106,189,631 V180L possibly damaging Het
Slc7a6 T A 8: 106,189,632 V180E probably damaging Het
Slc8b1 T A 5: 120,521,863 probably null Het
Slco1a4 G A 6: 141,819,479 Q346* probably null Het
Stk32b A G 5: 37,461,448 S229P probably damaging Het
Syde2 A G 3: 145,998,753 R487G probably benign Het
Tbc1d2b T C 9: 90,222,302 probably benign Het
Ticrr T C 7: 79,667,906 V396A probably benign Het
Trrap T C 5: 144,782,193 probably benign Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Wdr36 T G 18: 32,864,749 V820G possibly damaging Het
Wdr83 G A 8: 85,079,827 T114I possibly damaging Het
Zc3h7a T C 16: 11,139,147 N866S probably damaging Het
Zfc3h1 A G 10: 115,416,753 K1324E probably benign Het
Other mutations in Plcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Plcd3 APN 11 103077870 missense probably benign 0.16
IGL01906:Plcd3 APN 11 103076856 missense probably damaging 1.00
IGL02325:Plcd3 APN 11 103080621 nonsense probably null
IGL02634:Plcd3 APN 11 103077827 missense probably damaging 1.00
IGL02852:Plcd3 APN 11 103073805 missense probably damaging 1.00
IGL03025:Plcd3 APN 11 103074898 missense probably benign 0.24
IGL02837:Plcd3 UTSW 11 103071103 missense possibly damaging 0.92
IGL02988:Plcd3 UTSW 11 103076742 missense probably benign
R0055:Plcd3 UTSW 11 103077585 missense probably damaging 1.00
R0055:Plcd3 UTSW 11 103077585 missense probably damaging 1.00
R0452:Plcd3 UTSW 11 103071259 unclassified probably benign
R0529:Plcd3 UTSW 11 103080187 missense probably benign 0.00
R0556:Plcd3 UTSW 11 103077806 missense probably damaging 1.00
R1463:Plcd3 UTSW 11 103078373 missense probably damaging 1.00
R1752:Plcd3 UTSW 11 103080259 missense probably benign 0.01
R2157:Plcd3 UTSW 11 103071148 missense probably benign
R2519:Plcd3 UTSW 11 103080400 missense possibly damaging 0.80
R3809:Plcd3 UTSW 11 103101383 missense probably null 0.03
R4167:Plcd3 UTSW 11 103078464 missense probably damaging 0.98
R5100:Plcd3 UTSW 11 103078349 missense probably benign
R5387:Plcd3 UTSW 11 103078455 missense probably damaging 1.00
R5589:Plcd3 UTSW 11 103077803 missense probably benign 0.01
R5700:Plcd3 UTSW 11 103073763 missense probably benign 0.00
R5754:Plcd3 UTSW 11 103073766 missense possibly damaging 0.67
R5936:Plcd3 UTSW 11 103078347 missense probably damaging 1.00
R6059:Plcd3 UTSW 11 103080401 missense possibly damaging 0.80
R6102:Plcd3 UTSW 11 103080644 missense probably damaging 0.99
R6480:Plcd3 UTSW 11 103074931 missense possibly damaging 0.79
R6481:Plcd3 UTSW 11 103077767 missense probably damaging 1.00
R6566:Plcd3 UTSW 11 103073800 missense probably damaging 1.00
R7098:Plcd3 UTSW 11 103077863 missense probably damaging 1.00
R7165:Plcd3 UTSW 11 103079613 missense probably damaging 1.00
R7392:Plcd3 UTSW 11 103101557 unclassified probably benign
R7484:Plcd3 UTSW 11 103071719 missense probably damaging 1.00
R7606:Plcd3 UTSW 11 103076857 missense probably damaging 1.00
R7777:Plcd3 UTSW 11 103074655 missense probably benign 0.33
R7857:Plcd3 UTSW 11 103077934 missense probably benign 0.12
R8349:Plcd3 UTSW 11 103074670 missense probably damaging 1.00
R8449:Plcd3 UTSW 11 103074670 missense probably damaging 1.00
X0023:Plcd3 UTSW 11 103080208 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGAAGGCAACTCCAAACCTCTCTC -3'
(R):5'- GTTAGGAACAAGCACTCCAGTCCTC -3'

Sequencing Primer
(F):5'- AAAGTCAGAGTCTTTACCTGGTCC -3'
(R):5'- TCCCAGTGGTGCCTGAC -3'
Posted On2013-06-11