Incidental Mutation 'R0440:Armc9'
ID46668
Institutional Source Beutler Lab
Gene Symbol Armc9
Ensembl Gene ENSMUSG00000062590
Gene Namearmadillo repeat containing 9
Synonyms5730415N24Rik, 3830422A13Rik, 4831423D23Rik, 4930438O05Rik
MMRRC Submission 038641-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.569) question?
Stock #R0440 (G1)
Quality Score158
Status Validated (trace)
Chromosome1
Chromosomal Location86154780-86278284 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 86194262 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027434] [ENSMUST00000027434] [ENSMUST00000113309] [ENSMUST00000131412] [ENSMUST00000131412] [ENSMUST00000150059]
Predicted Effect probably null
Transcript: ENSMUST00000027434
SMART Domains Protein: ENSMUSP00000027434
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 8e-14 SMART
low complexity region 793 807 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000027434
SMART Domains Protein: ENSMUSP00000027434
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 8e-14 SMART
low complexity region 793 807 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113309
SMART Domains Protein: ENSMUSP00000108934
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 8e-14 SMART
low complexity region 794 808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123618
Predicted Effect probably null
Transcript: ENSMUST00000131412
SMART Domains Protein: ENSMUSP00000117267
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 4e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131412
SMART Domains Protein: ENSMUSP00000117267
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 4e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135973
Predicted Effect probably null
Transcript: ENSMUST00000150059
SMART Domains Protein: ENSMUSP00000116908
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
SCOP:d1qbkb_ 1 168 4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155168
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,228,493 R30W probably damaging Het
Adam7 T C 14: 68,510,856 probably null Het
Agl A T 3: 116,758,806 L1158Q probably damaging Het
Akap9 T C 5: 4,064,569 S66P probably damaging Het
Akr1c20 T A 13: 4,487,208 D316V probably benign Het
App C A 16: 85,056,414 E259* probably null Het
Arhgef4 A G 1: 34,745,448 probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Btaf1 C T 19: 36,986,653 P875S probably damaging Het
Cc2d1b T A 4: 108,625,816 probably null Het
Ccar1 C T 10: 62,780,457 V165I possibly damaging Het
Ccdc106 A T 7: 5,060,245 I250F probably damaging Het
Ccny T C 18: 9,332,917 I205V probably benign Het
Cfap52 T A 11: 67,954,088 I52L probably benign Het
Chd8 T A 14: 52,204,826 T2096S possibly damaging Het
Clstn3 G A 6: 124,451,413 T423I probably damaging Het
Col13a1 T C 10: 61,867,483 D440G possibly damaging Het
Dclk3 G A 9: 111,469,163 V592M probably damaging Het
Ddx31 A T 2: 28,857,132 I208F probably damaging Het
Dlat A T 9: 50,645,119 probably null Het
Eml4 T C 17: 83,446,058 probably null Het
Enpp2 T A 15: 54,847,237 probably benign Het
Fryl T C 5: 73,086,972 S38G possibly damaging Het
Gcnt1 G A 19: 17,330,316 T15I probably benign Het
Gm21834 T C 17: 57,742,126 T32A possibly damaging Het
Golga2 A G 2: 32,302,933 D394G probably damaging Het
Gtf3c4 G T 2: 28,840,169 probably null Het
Igkv4-69 A G 6: 69,284,269 probably benign Het
Inpp5j T C 11: 3,501,150 R500G possibly damaging Het
Kif5b A T 18: 6,226,980 probably benign Het
Klhl36 A G 8: 119,876,551 E515G probably damaging Het
Lifr C T 15: 7,157,191 R59* probably null Het
Lrif1 A T 3: 106,734,398 Q10L possibly damaging Het
Lrp8 A G 4: 107,869,098 E908G probably damaging Het
Lrrc23 A T 6: 124,770,704 D307E probably benign Het
Mpv17l T C 16: 13,944,719 F27L probably damaging Het
Mta3 C T 17: 83,766,587 A76V probably damaging Het
Muc5ac T A 7: 141,792,034 Y202* probably null Het
Naprt A G 15: 75,891,069 probably benign Het
Npr2 T A 4: 43,650,315 V960D probably damaging Het
Oca2 A T 7: 56,423,352 Y765F probably benign Het
Olfr715 A T 7: 107,128,732 H220Q probably benign Het
Plxna2 T A 1: 194,644,404 Y215* probably null Het
Prdm16 G A 4: 154,476,627 probably benign Het
Ptn A G 6: 36,744,497 S3P probably benign Het
Pus10 T C 11: 23,673,331 probably benign Het
Rad21 A T 15: 51,968,358 D442E probably benign Het
Rmdn2 A G 17: 79,667,955 H291R probably damaging Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Samd4b A T 7: 28,408,160 I228N probably benign Het
Sdr9c7 G T 10: 127,898,953 probably benign Het
Slc13a2 T C 11: 78,403,175 N254D probably benign Het
Slc16a8 T A 15: 79,252,607 I132F probably damaging Het
Slc18b1 T A 10: 23,819,078 Y274N probably benign Het
Slc45a2 A T 15: 11,000,817 M1L probably benign Het
Smc1b A G 15: 85,112,673 probably benign Het
Stab2 T C 10: 86,949,928 S617G probably benign Het
Stk10 A G 11: 32,604,190 M626V probably damaging Het
Synpo2l T G 14: 20,661,398 I385L possibly damaging Het
Tmprss11d T C 5: 86,338,812 Y73C probably damaging Het
Ttc21b A G 2: 66,236,382 V309A probably benign Het
Tubgcp6 A G 15: 89,103,065 I1235T probably benign Het
Usp8 A G 2: 126,725,390 I110V probably benign Het
Vps13c G A 9: 67,972,861 G3442S probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp207 T A 11: 80,395,507 probably benign Het
Zfp748 A C 13: 67,553,025 probably null Het
Other mutations in Armc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Armc9 APN 1 86198339 missense probably damaging 1.00
IGL00771:Armc9 APN 1 86199835 splice site probably null
IGL01689:Armc9 APN 1 86274418 missense probably benign
IGL02143:Armc9 APN 1 86176865 missense possibly damaging 0.58
IGL02680:Armc9 APN 1 86252278 missense probably damaging 1.00
IGL02812:Armc9 APN 1 86244571 missense probably damaging 0.99
IGL02887:Armc9 APN 1 86164835 missense probably damaging 1.00
IGL03011:Armc9 APN 1 86199916 critical splice donor site probably null
IGL03309:Armc9 APN 1 86274433 missense possibly damaging 0.54
R0184:Armc9 UTSW 1 86198370 missense probably damaging 1.00
R0787:Armc9 UTSW 1 86202505 missense probably damaging 0.99
R0849:Armc9 UTSW 1 86257270 missense probably benign 0.00
R1687:Armc9 UTSW 1 86156955 start codon destroyed probably null 1.00
R1962:Armc9 UTSW 1 86207974 missense probably damaging 1.00
R2176:Armc9 UTSW 1 86199892 missense probably damaging 1.00
R3418:Armc9 UTSW 1 86194338 missense probably damaging 1.00
R3419:Armc9 UTSW 1 86194338 missense probably damaging 1.00
R4079:Armc9 UTSW 1 86213129 intron probably benign
R4112:Armc9 UTSW 1 86188939 missense possibly damaging 0.80
R4151:Armc9 UTSW 1 86164775 missense probably damaging 1.00
R4675:Armc9 UTSW 1 86202518 missense probably damaging 1.00
R4934:Armc9 UTSW 1 86213079 missense probably damaging 1.00
R4944:Armc9 UTSW 1 86274534 missense probably damaging 0.98
R5069:Armc9 UTSW 1 86257237 missense probably benign 0.03
R5070:Armc9 UTSW 1 86257237 missense probably benign 0.03
R5071:Armc9 UTSW 1 86186116 missense probably benign 0.01
R5238:Armc9 UTSW 1 86199847 missense probably benign 0.01
R5386:Armc9 UTSW 1 86198289 missense probably null 1.00
R5459:Armc9 UTSW 1 86207972 missense probably damaging 0.97
R6027:Armc9 UTSW 1 86244667 missense probably damaging 1.00
R6144:Armc9 UTSW 1 86244579 missense probably benign 0.06
R7111:Armc9 UTSW 1 86159995 missense probably damaging 1.00
R7237:Armc9 UTSW 1 86164849 missense possibly damaging 0.82
R7304:Armc9 UTSW 1 86162715 missense probably benign
R7452:Armc9 UTSW 1 86213092 missense possibly damaging 0.87
R7555:Armc9 UTSW 1 86275678 missense probably damaging 1.00
R7805:Armc9 UTSW 1 86196319 missense probably damaging 1.00
R8513:Armc9 UTSW 1 86162683 missense probably damaging 1.00
Z1177:Armc9 UTSW 1 86176825 missense probably damaging 0.97
Z1177:Armc9 UTSW 1 86196355 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAACTCAGGGGATTTGTCCTTGC -3'
(R):5'- TTTGCCAGGACTGCTCTGCTTAG -3'

Sequencing Primer
(F):5'- CTGTGATTTATCTCAGGGTCTAGAAC -3'
(R):5'- CTGCTCTGCTTAGAGGAAAACATC -3'
Posted On2013-06-11