Incidental Mutation 'R0440:Ttc21b'
ID46673
Institutional Source Beutler Lab
Gene Symbol Ttc21b
Ensembl Gene ENSMUSG00000034848
Gene Nametetratricopeptide repeat domain 21B
Synonymsline 158, Thm1, aln, 2410066K11Rik
MMRRC Submission 038641-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0440 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location66184327-66256617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66236382 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 309 (V309A)
Ref Sequence ENSEMBL: ENSMUSP00000131758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102718] [ENSMUST00000125446]
Predicted Effect probably benign
Transcript: ENSMUST00000102718
AA Change: V309A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099779
Gene: ENSMUSG00000034848
AA Change: V309A

DomainStartEndE-ValueType
Blast:TPR 109 141 5e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 5e-13 BLAST
Blast:TPR 1156 1189 1e-12 BLAST
TPR 1196 1229 9.7e0 SMART
TPR 1265 1298 1.02e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125446
AA Change: V309A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131758
Gene: ENSMUSG00000034848
AA Change: V309A

DomainStartEndE-ValueType
Blast:TPR 108 141 3e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 4e-13 BLAST
Blast:TPR 1156 1189 9e-13 BLAST
TPR 1196 1229 9.7e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169968
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of TTC21 family, containing several tetratricopeptide repeat (TPR) domains. This protein is localized to the cilium axoneme, and may play a role in retrograde intraflagellar transport in cilia. Mutations in this gene are associated with various ciliopathies, nephronophthisis 12, and asphyxiating thoracic dystrophy 4. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene is embryonic lethal. Mutant embryos exhibit several deformities including polydactyly, microphthalmia, irregular shape of the long bones, rib fusion and truncation, neural tube defects, and abnormal brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,228,493 R30W probably damaging Het
Adam7 T C 14: 68,510,856 probably null Het
Agl A T 3: 116,758,806 L1158Q probably damaging Het
Akap9 T C 5: 4,064,569 S66P probably damaging Het
Akr1c20 T A 13: 4,487,208 D316V probably benign Het
App C A 16: 85,056,414 E259* probably null Het
Arhgef4 A G 1: 34,745,448 probably null Het
Armc9 G A 1: 86,194,262 probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Btaf1 C T 19: 36,986,653 P875S probably damaging Het
Cc2d1b T A 4: 108,625,816 probably null Het
Ccar1 C T 10: 62,780,457 V165I possibly damaging Het
Ccdc106 A T 7: 5,060,245 I250F probably damaging Het
Ccny T C 18: 9,332,917 I205V probably benign Het
Cfap52 T A 11: 67,954,088 I52L probably benign Het
Chd8 T A 14: 52,204,826 T2096S possibly damaging Het
Clstn3 G A 6: 124,451,413 T423I probably damaging Het
Col13a1 T C 10: 61,867,483 D440G possibly damaging Het
Dclk3 G A 9: 111,469,163 V592M probably damaging Het
Ddx31 A T 2: 28,857,132 I208F probably damaging Het
Dlat A T 9: 50,645,119 probably null Het
Eml4 T C 17: 83,446,058 probably null Het
Enpp2 T A 15: 54,847,237 probably benign Het
Fryl T C 5: 73,086,972 S38G possibly damaging Het
Gcnt1 G A 19: 17,330,316 T15I probably benign Het
Gm21834 T C 17: 57,742,126 T32A possibly damaging Het
Golga2 A G 2: 32,302,933 D394G probably damaging Het
Gtf3c4 G T 2: 28,840,169 probably null Het
Igkv4-69 A G 6: 69,284,269 probably benign Het
Inpp5j T C 11: 3,501,150 R500G possibly damaging Het
Kif5b A T 18: 6,226,980 probably benign Het
Klhl36 A G 8: 119,876,551 E515G probably damaging Het
Lifr C T 15: 7,157,191 R59* probably null Het
Lrif1 A T 3: 106,734,398 Q10L possibly damaging Het
Lrp8 A G 4: 107,869,098 E908G probably damaging Het
Lrrc23 A T 6: 124,770,704 D307E probably benign Het
Mpv17l T C 16: 13,944,719 F27L probably damaging Het
Mta3 C T 17: 83,766,587 A76V probably damaging Het
Muc5ac T A 7: 141,792,034 Y202* probably null Het
Naprt A G 15: 75,891,069 probably benign Het
Npr2 T A 4: 43,650,315 V960D probably damaging Het
Oca2 A T 7: 56,423,352 Y765F probably benign Het
Olfr715 A T 7: 107,128,732 H220Q probably benign Het
Plxna2 T A 1: 194,644,404 Y215* probably null Het
Prdm16 G A 4: 154,476,627 probably benign Het
Ptn A G 6: 36,744,497 S3P probably benign Het
Pus10 T C 11: 23,673,331 probably benign Het
Rad21 A T 15: 51,968,358 D442E probably benign Het
Rmdn2 A G 17: 79,667,955 H291R probably damaging Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Samd4b A T 7: 28,408,160 I228N probably benign Het
Sdr9c7 G T 10: 127,898,953 probably benign Het
Slc13a2 T C 11: 78,403,175 N254D probably benign Het
Slc16a8 T A 15: 79,252,607 I132F probably damaging Het
Slc18b1 T A 10: 23,819,078 Y274N probably benign Het
Slc45a2 A T 15: 11,000,817 M1L probably benign Het
Smc1b A G 15: 85,112,673 probably benign Het
Stab2 T C 10: 86,949,928 S617G probably benign Het
Stk10 A G 11: 32,604,190 M626V probably damaging Het
Synpo2l T G 14: 20,661,398 I385L possibly damaging Het
Tmprss11d T C 5: 86,338,812 Y73C probably damaging Het
Tubgcp6 A G 15: 89,103,065 I1235T probably benign Het
Usp8 A G 2: 126,725,390 I110V probably benign Het
Vps13c G A 9: 67,972,861 G3442S probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp207 T A 11: 80,395,507 probably benign Het
Zfp748 A C 13: 67,553,025 probably null Het
Other mutations in Ttc21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Ttc21b APN 2 66242775 missense probably benign 0.00
IGL00467:Ttc21b APN 2 66188364 missense probably damaging 1.00
IGL00721:Ttc21b APN 2 66226778 missense probably benign 0.06
IGL00837:Ttc21b APN 2 66235571 critical splice donor site probably null
IGL01317:Ttc21b APN 2 66188356 missense probably benign 0.00
IGL01485:Ttc21b APN 2 66251890 splice site probably benign
IGL01739:Ttc21b APN 2 66237856 missense probably benign
IGL02282:Ttc21b APN 2 66191737 missense probably damaging 0.96
IGL02431:Ttc21b APN 2 66251885 splice site probably benign
IGL02478:Ttc21b APN 2 66188280 missense probably benign 0.05
IGL02487:Ttc21b APN 2 66235156 missense probably benign 0.02
IGL03327:Ttc21b APN 2 66237848 missense possibly damaging 0.92
IGL03346:Ttc21b APN 2 66237848 missense possibly damaging 0.92
plus-sized UTSW 2 66242679 missense probably damaging 1.00
PIT4696001:Ttc21b UTSW 2 66231219 splice site probably null
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0373:Ttc21b UTSW 2 66188326 missense probably damaging 0.99
R0504:Ttc21b UTSW 2 66222798 splice site probably benign
R0600:Ttc21b UTSW 2 66239570 missense probably damaging 0.99
R0621:Ttc21b UTSW 2 66226011 missense probably benign 0.07
R0633:Ttc21b UTSW 2 66236233 missense probably benign
R0863:Ttc21b UTSW 2 66242773 missense probably benign
R1617:Ttc21b UTSW 2 66226035 missense probably benign 0.22
R1837:Ttc21b UTSW 2 66197762 missense probably benign 0.01
R1844:Ttc21b UTSW 2 66223577 nonsense probably null
R2120:Ttc21b UTSW 2 66226754 missense probably benign 0.12
R2205:Ttc21b UTSW 2 66235123 missense possibly damaging 0.51
R2392:Ttc21b UTSW 2 66207450 critical splice donor site probably null
R3689:Ttc21b UTSW 2 66224144 missense probably benign 0.22
R3810:Ttc21b UTSW 2 66252233 critical splice acceptor site probably null
R3847:Ttc21b UTSW 2 66242679 missense probably damaging 1.00
R3897:Ttc21b UTSW 2 66235069 missense probably benign 0.01
R4561:Ttc21b UTSW 2 66186218 missense probably damaging 1.00
R4671:Ttc21b UTSW 2 66226913 missense possibly damaging 0.66
R5161:Ttc21b UTSW 2 66229023 missense probably damaging 0.98
R5274:Ttc21b UTSW 2 66236283 missense possibly damaging 0.89
R5594:Ttc21b UTSW 2 66236235 missense probably benign 0.39
R6210:Ttc21b UTSW 2 66236354 missense probably benign 0.00
R6305:Ttc21b UTSW 2 66188270 missense probably damaging 0.99
R6456:Ttc21b UTSW 2 66188331 missense probably damaging 0.97
R6482:Ttc21b UTSW 2 66226900 missense probably benign 0.12
R6645:Ttc21b UTSW 2 66236377 missense probably benign 0.01
R6800:Ttc21b UTSW 2 66208650 splice site probably null
R6815:Ttc21b UTSW 2 66226790 missense probably benign 0.00
R6959:Ttc21b UTSW 2 66231312 missense probably benign 0.05
R7125:Ttc21b UTSW 2 66236326 missense probably benign 0.00
R7265:Ttc21b UTSW 2 66210173 missense possibly damaging 0.89
R7283:Ttc21b UTSW 2 66208718 missense probably damaging 0.96
R7560:Ttc21b UTSW 2 66217204 missense possibly damaging 0.69
R7561:Ttc21b UTSW 2 66217204 missense possibly damaging 0.69
R7816:Ttc21b UTSW 2 66247361 missense possibly damaging 0.82
R8172:Ttc21b UTSW 2 66252156 missense probably benign 0.01
R8179:Ttc21b UTSW 2 66201480 missense probably benign
X0013:Ttc21b UTSW 2 66225950 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGCAGAGATGTTGCTCTCATTCAG -3'
(R):5'- TGCCCTAAATGGAAAGGGGACTTTTAC -3'

Sequencing Primer
(F):5'- CCGAGCTCTGTAGCAATTTC -3'
(R):5'- TGTGTCAAGATGGCAATGTCAC -3'
Posted On2013-06-11