Incidental Mutation 'R0440:Akap9'
ID 46681
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene Name A kinase (PRKA) anchor protein (yotiao) 9
Synonyms AKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
MMRRC Submission 038641-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock # R0440 (G1)
Quality Score 210
Status Validated (trace)
Chromosome 5
Chromosomal Location 3928054-4081310 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4064569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 66 (S66P)
Ref Sequence ENSEMBL: ENSMUSP00000135836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000176863]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044492
AA Change: S3283P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: S3283P

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147629
Predicted Effect probably damaging
Transcript: ENSMUST00000176863
AA Change: S66P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135836
Gene: ENSMUSG00000040407
AA Change: S66P

DomainStartEndE-ValueType
coiled coil region 1 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197366
Meta Mutation Damage Score 0.1377 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,228,493 R30W probably damaging Het
Adam7 T C 14: 68,510,856 probably null Het
Agl A T 3: 116,758,806 L1158Q probably damaging Het
Akr1c20 T A 13: 4,487,208 D316V probably benign Het
App C A 16: 85,056,414 E259* probably null Het
Arhgef4 A G 1: 34,745,448 probably null Het
Armc9 G A 1: 86,194,262 probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Btaf1 C T 19: 36,986,653 P875S probably damaging Het
Cc2d1b T A 4: 108,625,816 probably null Het
Ccar1 C T 10: 62,780,457 V165I possibly damaging Het
Ccdc106 A T 7: 5,060,245 I250F probably damaging Het
Ccny T C 18: 9,332,917 I205V probably benign Het
Cfap52 T A 11: 67,954,088 I52L probably benign Het
Chd8 T A 14: 52,204,826 T2096S possibly damaging Het
Clstn3 G A 6: 124,451,413 T423I probably damaging Het
Col13a1 T C 10: 61,867,483 D440G possibly damaging Het
Dclk3 G A 9: 111,469,163 V592M probably damaging Het
Ddx31 A T 2: 28,857,132 I208F probably damaging Het
Dlat A T 9: 50,645,119 probably null Het
Eml4 T C 17: 83,446,058 probably null Het
Enpp2 T A 15: 54,847,237 probably benign Het
Fryl T C 5: 73,086,972 S38G possibly damaging Het
Gcnt1 G A 19: 17,330,316 T15I probably benign Het
Gm21834 T C 17: 57,742,126 T32A possibly damaging Het
Golga2 A G 2: 32,302,933 D394G probably damaging Het
Gtf3c4 G T 2: 28,840,169 probably null Het
Igkv4-69 A G 6: 69,284,269 probably benign Het
Inpp5j T C 11: 3,501,150 R500G possibly damaging Het
Kif5b A T 18: 6,226,980 probably benign Het
Klhl36 A G 8: 119,876,551 E515G probably damaging Het
Lifr C T 15: 7,157,191 R59* probably null Het
Lrif1 A T 3: 106,734,398 Q10L possibly damaging Het
Lrp8 A G 4: 107,869,098 E908G probably damaging Het
Lrrc23 A T 6: 124,770,704 D307E probably benign Het
Mpv17l T C 16: 13,944,719 F27L probably damaging Het
Mta3 C T 17: 83,766,587 A76V probably damaging Het
Muc5ac T A 7: 141,792,034 Y202* probably null Het
Naprt A G 15: 75,891,069 probably benign Het
Npr2 T A 4: 43,650,315 V960D probably damaging Het
Oca2 A T 7: 56,423,352 Y765F probably benign Het
Olfr715 A T 7: 107,128,732 H220Q probably benign Het
Plxna2 T A 1: 194,644,404 Y215* probably null Het
Prdm16 G A 4: 154,476,627 probably benign Het
Ptn A G 6: 36,744,497 S3P probably benign Het
Pus10 T C 11: 23,673,331 probably benign Het
Rad21 A T 15: 51,968,358 D442E probably benign Het
Rmdn2 A G 17: 79,667,955 H291R probably damaging Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Samd4b A T 7: 28,408,160 I228N probably benign Het
Sdr9c7 G T 10: 127,898,953 probably benign Het
Slc13a2 T C 11: 78,403,175 N254D probably benign Het
Slc16a8 T A 15: 79,252,607 I132F probably damaging Het
Slc18b1 T A 10: 23,819,078 Y274N probably benign Het
Slc45a2 A T 15: 11,000,817 M1L probably benign Het
Smc1b A G 15: 85,112,673 probably benign Het
Stab2 T C 10: 86,949,928 S617G probably benign Het
Stk10 A G 11: 32,604,190 M626V probably damaging Het
Synpo2l T G 14: 20,661,398 I385L possibly damaging Het
Tmprss11d T C 5: 86,338,812 Y73C probably damaging Het
Ttc21b A G 2: 66,236,382 V309A probably benign Het
Tubgcp6 A G 15: 89,103,065 I1235T probably benign Het
Usp8 A G 2: 126,725,390 I110V probably benign Het
Vps13c G A 9: 67,972,861 G3442S probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp207 T A 11: 80,395,507 probably benign Het
Zfp748 A C 13: 67,553,025 probably null Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
Andy UTSW 5 3961764 nonsense probably null
blimey UTSW 5 4070397 nonsense probably null
marinarum UTSW 5 4013875 nonsense probably null
naviculus UTSW 5 3960865 missense probably damaging 0.98
wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0387:Akap9 UTSW 5 3951678 splice site probably benign
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0611:Akap9 UTSW 5 3954870 missense probably benign 0.00
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 splice site probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 splice site probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1713:Akap9 UTSW 5 4039345 critical splice donor site probably null
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1720:Akap9 UTSW 5 3972791 missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4749:Akap9 UTSW 5 3968737 missense probably benign 0.41
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5200:Akap9 UTSW 5 3960734 missense probably benign 0.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4064714 missense possibly damaging 0.93
R5619:Akap9 UTSW 5 3954760 intron probably benign
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5697:Akap9 UTSW 5 3960170 missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 splice site probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
R7164:Akap9 UTSW 5 4060364 missense probably damaging 0.96
R7170:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7192:Akap9 UTSW 5 4005723 splice site probably null
R7284:Akap9 UTSW 5 3956246 missense probably damaging 1.00
R7299:Akap9 UTSW 5 4032696 missense probably damaging 1.00
R7313:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7326:Akap9 UTSW 5 4045930 missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4046364 missense probably damaging 0.99
R7455:Akap9 UTSW 5 3972792 missense probably benign 0.03
R7482:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7489:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7525:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7528:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7576:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7577:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7578:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7610:Akap9 UTSW 5 3957677 missense possibly damaging 0.95
R7658:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7754:Akap9 UTSW 5 4046736 missense probably benign 0.03
R7818:Akap9 UTSW 5 4013875 nonsense probably null
R7979:Akap9 UTSW 5 4050381 missense probably benign
R7991:Akap9 UTSW 5 4064949 splice site probably null
R8036:Akap9 UTSW 5 4070397 nonsense probably null
R8054:Akap9 UTSW 5 4038707 critical splice donor site probably null
R8116:Akap9 UTSW 5 4061183 missense probably benign 0.04
R8150:Akap9 UTSW 5 3961982 missense probably damaging 1.00
R8234:Akap9 UTSW 5 4044845 missense probably benign 0.18
R8348:Akap9 UTSW 5 3948897 critical splice donor site probably null
R8365:Akap9 UTSW 5 3968745 missense probably benign 0.04
R8366:Akap9 UTSW 5 3968745 missense probably benign 0.04
R8448:Akap9 UTSW 5 3948897 critical splice donor site probably null
R8466:Akap9 UTSW 5 4038659 missense probably damaging 1.00
R8772:Akap9 UTSW 5 4046255 missense probably damaging 1.00
R8881:Akap9 UTSW 5 3961279 missense
R8937:Akap9 UTSW 5 4044048 missense possibly damaging 0.78
R8956:Akap9 UTSW 5 3948805 missense possibly damaging 0.79
R9000:Akap9 UTSW 5 4055650 missense probably benign
R9049:Akap9 UTSW 5 4064597 missense
R9074:Akap9 UTSW 5 4077959 missense probably benign 0.40
R9124:Akap9 UTSW 5 4061284 missense probably damaging 0.99
R9129:Akap9 UTSW 5 4069089 missense probably benign 0.00
R9371:Akap9 UTSW 5 3961852 missense possibly damaging 0.83
R9424:Akap9 UTSW 5 3962223 nonsense probably null
R9424:Akap9 UTSW 5 3962224 nonsense probably null
R9509:Akap9 UTSW 5 4046349 missense probably benign
R9515:Akap9 UTSW 5 4055709 missense probably damaging 1.00
R9567:Akap9 UTSW 5 4077311 missense possibly damaging 0.89
R9587:Akap9 UTSW 5 4069149 missense probably damaging 1.00
R9635:Akap9 UTSW 5 4050545 missense probably benign 0.20
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Z1176:Akap9 UTSW 5 3962251 missense probably damaging 0.96
Z1177:Akap9 UTSW 5 4046189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCCGCAACTTAGGGCTTCAAG -3'
(R):5'- TGAGTGTAGCAATGCCATAGGGCAG -3'

Sequencing Primer
(F):5'- GCCTTCTGAGGACCTACTTAAAGAG -3'
(R):5'- CTGCCTCAGAAATACTGTAAAGG -3'
Posted On 2013-06-11