Mutagenetix > Incidental Mutation

Incidental Mutation 'R0440:Clstn3'

46686

Institutional Source

Beutler Lab

Gene Symbol

Clstn3

Ensembl Gene

ENSMUSG00000008153

Gene Name

calsyntenin 3

Synonyms

alcadein-beta, Cst-3, CSTN3

MMRRC Submission

038641-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0440 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

124430759-124464794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 124451413 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 423 (T423I)

Ref Sequence

ENSEMBL: ENSMUSP00000108142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523]

AlphaFold

Q99JH7

Predicted Effect

probably damaging
Transcript: ENSMUST00000008297
AA Change: T460I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: T460I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
CA	50	143	2.72e-12	SMART
CA	166	244	4.04e-2	SMART
SCOP:d1a8d_1	333	549	7e-23	SMART
transmembrane domain	846	868	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112523
AA Change: T423I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: T423I

Domain	Start	End	E-Value	Type
CA	13	106	2.72e-12	SMART
CA	129	207	4.04e-2	SMART
Pfam:Laminin_G_3	304	505	4.1e-8	PFAM
transmembrane domain	809	831	N/A	INTRINSIC
low complexity region	891	908	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147947

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156040

Meta Mutation Damage Score

0.1944

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 97.0%
20x: 94.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4galt	G	A	15: 83,228,493	R30W	probably damaging	Het
Adam7	T	C	14: 68,510,856		probably null	Het
Agl	A	T	3: 116,758,806	L1158Q	probably damaging	Het
Akap9	T	C	5: 4,064,569	S66P	probably damaging	Het
Akr1c20	T	A	13: 4,487,208	D316V	probably benign	Het
App	C	A	16: 85,056,414	E259*	probably null	Het
Arhgef4	A	G	1: 34,745,448		probably null	Het
Armc9	G	A	1: 86,194,262		probably null	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Btaf1	C	T	19: 36,986,653	P875S	probably damaging	Het
Cc2d1b	T	A	4: 108,625,816		probably null	Het
Ccar1	C	T	10: 62,780,457	V165I	possibly damaging	Het
Ccdc106	A	T	7: 5,060,245	I250F	probably damaging	Het
Ccny	T	C	18: 9,332,917	I205V	probably benign	Het
Cfap52	T	A	11: 67,954,088	I52L	probably benign	Het
Chd8	T	A	14: 52,204,826	T2096S	possibly damaging	Het
Col13a1	T	C	10: 61,867,483	D440G	possibly damaging	Het
Dclk3	G	A	9: 111,469,163	V592M	probably damaging	Het
Ddx31	A	T	2: 28,857,132	I208F	probably damaging	Het
Dlat	A	T	9: 50,645,119		probably null	Het
Eml4	T	C	17: 83,446,058		probably null	Het
Enpp2	T	A	15: 54,847,237		probably benign	Het
Fryl	T	C	5: 73,086,972	S38G	possibly damaging	Het
Gcnt1	G	A	19: 17,330,316	T15I	probably benign	Het
Gm21834	T	C	17: 57,742,126	T32A	possibly damaging	Het
Golga2	A	G	2: 32,302,933	D394G	probably damaging	Het
Gtf3c4	G	T	2: 28,840,169		probably null	Het
Igkv4-69	A	G	6: 69,284,269		probably benign	Het
Inpp5j	T	C	11: 3,501,150	R500G	possibly damaging	Het
Kif5b	A	T	18: 6,226,980		probably benign	Het
Klhl36	A	G	8: 119,876,551	E515G	probably damaging	Het
Lifr	C	T	15: 7,157,191	R59*	probably null	Het
Lrif1	A	T	3: 106,734,398	Q10L	possibly damaging	Het
Lrp8	A	G	4: 107,869,098	E908G	probably damaging	Het
Lrrc23	A	T	6: 124,770,704	D307E	probably benign	Het
Mpv17l	T	C	16: 13,944,719	F27L	probably damaging	Het
Mta3	C	T	17: 83,766,587	A76V	probably damaging	Het
Muc5ac	T	A	7: 141,792,034	Y202*	probably null	Het
Naprt	A	G	15: 75,891,069		probably benign	Het
Npr2	T	A	4: 43,650,315	V960D	probably damaging	Het
Oca2	A	T	7: 56,423,352	Y765F	probably benign	Het
Olfr715	A	T	7: 107,128,732	H220Q	probably benign	Het
Plxna2	T	A	1: 194,644,404	Y215*	probably null	Het
Prdm16	G	A	4: 154,476,627		probably benign	Het
Ptn	A	G	6: 36,744,497	S3P	probably benign	Het
Pus10	T	C	11: 23,673,331		probably benign	Het
Rad21	A	T	15: 51,968,358	D442E	probably benign	Het
Rmdn2	A	G	17: 79,667,955	H291R	probably damaging	Het
Rp1	A	G	1: 4,345,640	S1750P	probably damaging	Het
Samd4b	A	T	7: 28,408,160	I228N	probably benign	Het
Sdr9c7	G	T	10: 127,898,953		probably benign	Het
Slc13a2	T	C	11: 78,403,175	N254D	probably benign	Het
Slc16a8	T	A	15: 79,252,607	I132F	probably damaging	Het
Slc18b1	T	A	10: 23,819,078	Y274N	probably benign	Het
Slc45a2	A	T	15: 11,000,817	M1L	probably benign	Het
Smc1b	A	G	15: 85,112,673		probably benign	Het
Stab2	T	C	10: 86,949,928	S617G	probably benign	Het
Stk10	A	G	11: 32,604,190	M626V	probably damaging	Het
Synpo2l	T	G	14: 20,661,398	I385L	possibly damaging	Het
Tmprss11d	T	C	5: 86,338,812	Y73C	probably damaging	Het
Ttc21b	A	G	2: 66,236,382	V309A	probably benign	Het
Tubgcp6	A	G	15: 89,103,065	I1235T	probably benign	Het
Usp8	A	G	2: 126,725,390	I110V	probably benign	Het
Vps13c	G	A	9: 67,972,861	G3442S	probably damaging	Het
Wdr59	GGGTGGTG	GGGTG	8: 111,480,540		probably benign	Het
Zfp207	T	A	11: 80,395,507		probably benign	Het
Zfp748	A	C	13: 67,553,025		probably null	Het

Other mutations in Clstn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Clstn3	APN	6	124462139	missense	probably damaging	1.00
IGL01415:Clstn3	APN	6	124438822	nonsense	probably null
IGL01521:Clstn3	APN	6	124458031	nonsense	probably null
IGL01537:Clstn3	APN	6	124431600	missense	possibly damaging	0.91
IGL01729:Clstn3	APN	6	124449794	missense	probably benign	0.06
IGL01879:Clstn3	APN	6	124438810	missense	probably damaging	1.00
IGL01998:Clstn3	APN	6	124458663	missense	probably damaging	1.00
IGL03130:Clstn3	APN	6	124459263	missense	probably damaging	0.98
IGL03405:Clstn3	APN	6	124438368	missense	possibly damaging	0.95
PIT4403001:Clstn3	UTSW	6	124458023	missense	probably damaging	1.00
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0208:Clstn3	UTSW	6	124432169	splice site	probably benign
R0276:Clstn3	UTSW	6	124431740	splice site	probably benign
R0612:Clstn3	UTSW	6	124449500	missense	probably damaging	0.98
R1200:Clstn3	UTSW	6	124459170	missense	probably damaging	1.00
R1224:Clstn3	UTSW	6	124457919	missense	probably benign
R1378:Clstn3	UTSW	6	124438419	missense	probably damaging	1.00
R1491:Clstn3	UTSW	6	124437490	missense	possibly damaging	0.51
R1495:Clstn3	UTSW	6	124449917	missense	probably benign	0.00
R1511:Clstn3	UTSW	6	124462169	missense	probably damaging	1.00
R1655:Clstn3	UTSW	6	124437427	missense	probably damaging	1.00
R1731:Clstn3	UTSW	6	124431632	missense	probably benign	0.04
R1734:Clstn3	UTSW	6	124436814	splice site	probably benign
R1751:Clstn3	UTSW	6	124431999	missense	probably damaging	1.00
R1954:Clstn3	UTSW	6	124459298	missense	possibly damaging	0.94
R2133:Clstn3	UTSW	6	124449503	missense	probably benign
R2192:Clstn3	UTSW	6	124459207	missense	probably damaging	1.00
R2314:Clstn3	UTSW	6	124450717	missense	probably benign	0.39
R2874:Clstn3	UTSW	6	124438335	missense	probably damaging	1.00
R3500:Clstn3	UTSW	6	124431711	missense	probably benign	0.01
R3761:Clstn3	UTSW	6	124457876	missense	possibly damaging	0.54
R3878:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R3927:Clstn3	UTSW	6	124451368	missense	probably damaging	1.00
R3934:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R3935:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R4063:Clstn3	UTSW	6	124449833	missense	possibly damaging	0.51
R4402:Clstn3	UTSW	6	124456980	missense	probably damaging	0.96
R4534:Clstn3	UTSW	6	124459220	missense	probably damaging	1.00
R4785:Clstn3	UTSW	6	124437372	splice site	probably null
R4834:Clstn3	UTSW	6	124431953	splice site	probably null
R5921:Clstn3	UTSW	6	124431580	utr 3 prime	probably benign
R5932:Clstn3	UTSW	6	124438332	missense	probably benign	0.01
R6025:Clstn3	UTSW	6	124431664	missense	possibly damaging	0.73
R6101:Clstn3	UTSW	6	124461670	missense	probably damaging	1.00
R6360:Clstn3	UTSW	6	124438429	missense	possibly damaging	0.88
R6578:Clstn3	UTSW	6	124450704	critical splice donor site	probably null
R6813:Clstn3	UTSW	6	124436935	missense	probably benign	0.00
R7380:Clstn3	UTSW	6	124456989	missense	probably benign	0.01
R7419:Clstn3	UTSW	6	124458129	missense	probably benign	0.05
R7625:Clstn3	UTSW	6	124437418	nonsense	probably null
R7780:Clstn3	UTSW	6	124462202	missense	probably damaging	0.98
R7936:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R7939:Clstn3	UTSW	6	124462199	missense	probably damaging	1.00
R8047:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R8079:Clstn3	UTSW	6	124459804	missense	probably damaging	1.00
R8085:Clstn3	UTSW	6	124458724	missense	probably benign	0.23
R8299:Clstn3	UTSW	6	124437373	critical splice donor site	probably null
R8406:Clstn3	UTSW	6	124462177	missense	probably damaging	1.00
R8685:Clstn3	UTSW	6	124456908	missense	probably damaging	1.00
R9045:Clstn3	UTSW	6	124431962	missense	probably damaging	0.98
R9209:Clstn3	UTSW	6	124431612	missense	probably benign	0.02
R9264:Clstn3	UTSW	6	124459768	missense	probably damaging	1.00
R9268:Clstn3	UTSW	6	124456921	missense	probably damaging	0.99
R9443:Clstn3	UTSW	6	124451399	missense	probably damaging	1.00
RF014:Clstn3	UTSW	6	124459266	nonsense	probably null
X0066:Clstn3	UTSW	6	124449811	missense	probably benign	0.13
Z1176:Clstn3	UTSW	6	124459200	missense	probably damaging	1.00
Z1177:Clstn3	UTSW	6	124449781	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAGAGAAGAGTCACCTTGCCTAGC -3'
(R):5'- TGCCTGCCCTGTAGATTTTGGAC -3'

Sequencing Primer
(F):5'- GAGTCACCTTGCCTAGCTATACAG -3'
(R):5'- CTATTCCTTGAGCAGAGTAGGCAG -3'

Posted On

2013-06-11