Incidental Mutation 'R0440:Clstn3'
ID 46686
Institutional Source Beutler Lab
Gene Symbol Clstn3
Ensembl Gene ENSMUSG00000008153
Gene Name calsyntenin 3
Synonyms Cst-3, CSTN3, alcadein-beta
MMRRC Submission 038641-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0440 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 6
Chromosomal Location 124407715-124441743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 124428372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 423 (T423I)
Ref Sequence ENSEMBL: ENSMUSP00000108142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523]
AlphaFold Q99JH7
Predicted Effect probably damaging
Transcript: ENSMUST00000008297
AA Change: T460I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: T460I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 50 143 2.72e-12 SMART
CA 166 244 4.04e-2 SMART
SCOP:d1a8d_1 333 549 7e-23 SMART
transmembrane domain 846 868 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112523
AA Change: T423I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: T423I

DomainStartEndE-ValueType
CA 13 106 2.72e-12 SMART
CA 129 207 4.04e-2 SMART
Pfam:Laminin_G_3 304 505 4.1e-8 PFAM
transmembrane domain 809 831 N/A INTRINSIC
low complexity region 891 908 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156040
Meta Mutation Damage Score 0.1944 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,112,694 (GRCm39) R30W probably damaging Het
Adam7 T C 14: 68,748,305 (GRCm39) probably null Het
Agl A T 3: 116,552,455 (GRCm39) L1158Q probably damaging Het
Akap9 T C 5: 4,114,569 (GRCm39) S66P probably damaging Het
Akr1c20 T A 13: 4,537,207 (GRCm39) D316V probably benign Het
App C A 16: 84,853,302 (GRCm39) E259* probably null Het
Arhgef4 A G 1: 34,784,529 (GRCm39) probably null Het
Armc9 G A 1: 86,121,984 (GRCm39) probably null Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Btaf1 C T 19: 36,964,053 (GRCm39) P875S probably damaging Het
Cc2d1b T A 4: 108,483,013 (GRCm39) probably null Het
Ccar1 C T 10: 62,616,236 (GRCm39) V165I possibly damaging Het
Ccdc106 A T 7: 5,063,244 (GRCm39) I250F probably damaging Het
Ccny T C 18: 9,332,917 (GRCm39) I205V probably benign Het
Cfap52 T A 11: 67,844,914 (GRCm39) I52L probably benign Het
Chd8 T A 14: 52,442,283 (GRCm39) T2096S possibly damaging Het
Col13a1 T C 10: 61,703,262 (GRCm39) D440G possibly damaging Het
Dclk3 G A 9: 111,298,231 (GRCm39) V592M probably damaging Het
Ddx31 A T 2: 28,747,144 (GRCm39) I208F probably damaging Het
Dlat A T 9: 50,556,419 (GRCm39) probably null Het
Eml4 T C 17: 83,753,487 (GRCm39) probably null Het
Enpp2 T A 15: 54,710,633 (GRCm39) probably benign Het
Fryl T C 5: 73,244,315 (GRCm39) S38G possibly damaging Het
Gcnt1 G A 19: 17,307,680 (GRCm39) T15I probably benign Het
Gm21834 T C 17: 58,049,121 (GRCm39) T32A possibly damaging Het
Golga2 A G 2: 32,192,945 (GRCm39) D394G probably damaging Het
Gtf3c4 G T 2: 28,730,181 (GRCm39) probably null Het
Igkv4-69 A G 6: 69,261,253 (GRCm39) probably benign Het
Inpp5j T C 11: 3,451,150 (GRCm39) R500G possibly damaging Het
Kif5b A T 18: 6,226,980 (GRCm39) probably benign Het
Klhl36 A G 8: 120,603,290 (GRCm39) E515G probably damaging Het
Lifr C T 15: 7,186,672 (GRCm39) R59* probably null Het
Lrif1 A T 3: 106,641,714 (GRCm39) Q10L possibly damaging Het
Lrp8 A G 4: 107,726,295 (GRCm39) E908G probably damaging Het
Lrrc23 A T 6: 124,747,667 (GRCm39) D307E probably benign Het
Mpv17l T C 16: 13,762,583 (GRCm39) F27L probably damaging Het
Mta3 C T 17: 84,074,016 (GRCm39) A76V probably damaging Het
Muc5ac T A 7: 141,345,771 (GRCm39) Y202* probably null Het
Naprt A G 15: 75,762,918 (GRCm39) probably benign Het
Npr2 T A 4: 43,650,315 (GRCm39) V960D probably damaging Het
Oca2 A T 7: 56,073,100 (GRCm39) Y765F probably benign Het
Or2d2 A T 7: 106,727,939 (GRCm39) H220Q probably benign Het
Plxna2 T A 1: 194,326,712 (GRCm39) Y215* probably null Het
Prdm16 G A 4: 154,561,084 (GRCm39) probably benign Het
Ptn A G 6: 36,721,432 (GRCm39) S3P probably benign Het
Pus10 T C 11: 23,623,331 (GRCm39) probably benign Het
Rad21 A T 15: 51,831,754 (GRCm39) D442E probably benign Het
Rmdn2 A G 17: 79,975,384 (GRCm39) H291R probably damaging Het
Rp1 A G 1: 4,415,863 (GRCm39) S1750P probably damaging Het
Samd4b A T 7: 28,107,585 (GRCm39) I228N probably benign Het
Sdr9c7 G T 10: 127,734,822 (GRCm39) probably benign Het
Slc13a2 T C 11: 78,294,001 (GRCm39) N254D probably benign Het
Slc16a8 T A 15: 79,136,807 (GRCm39) I132F probably damaging Het
Slc18b1 T A 10: 23,694,976 (GRCm39) Y274N probably benign Het
Slc45a2 A T 15: 11,000,903 (GRCm39) M1L probably benign Het
Smc1b A G 15: 84,996,874 (GRCm39) probably benign Het
Stab2 T C 10: 86,785,792 (GRCm39) S617G probably benign Het
Stk10 A G 11: 32,554,190 (GRCm39) M626V probably damaging Het
Synpo2l T G 14: 20,711,466 (GRCm39) I385L possibly damaging Het
Tmprss11d T C 5: 86,486,671 (GRCm39) Y73C probably damaging Het
Ttc21b A G 2: 66,066,726 (GRCm39) V309A probably benign Het
Tubgcp6 A G 15: 88,987,268 (GRCm39) I1235T probably benign Het
Usp8 A G 2: 126,567,310 (GRCm39) I110V probably benign Het
Vps13c G A 9: 67,880,143 (GRCm39) G3442S probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 112,207,172 (GRCm39) probably benign Het
Zfp207 T A 11: 80,286,333 (GRCm39) probably benign Het
Zfp748 A C 13: 67,701,144 (GRCm39) probably null Het
Other mutations in Clstn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Clstn3 APN 6 124,439,098 (GRCm39) missense probably damaging 1.00
IGL01415:Clstn3 APN 6 124,415,781 (GRCm39) nonsense probably null
IGL01521:Clstn3 APN 6 124,434,990 (GRCm39) nonsense probably null
IGL01537:Clstn3 APN 6 124,408,559 (GRCm39) missense possibly damaging 0.91
IGL01729:Clstn3 APN 6 124,426,753 (GRCm39) missense probably benign 0.06
IGL01879:Clstn3 APN 6 124,415,769 (GRCm39) missense probably damaging 1.00
IGL01998:Clstn3 APN 6 124,435,622 (GRCm39) missense probably damaging 1.00
IGL03130:Clstn3 APN 6 124,436,222 (GRCm39) missense probably damaging 0.98
IGL03405:Clstn3 APN 6 124,415,327 (GRCm39) missense possibly damaging 0.95
PIT4403001:Clstn3 UTSW 6 124,434,982 (GRCm39) missense probably damaging 1.00
R0049:Clstn3 UTSW 6 124,436,812 (GRCm39) missense possibly damaging 0.87
R0049:Clstn3 UTSW 6 124,436,812 (GRCm39) missense possibly damaging 0.87
R0208:Clstn3 UTSW 6 124,409,128 (GRCm39) splice site probably benign
R0276:Clstn3 UTSW 6 124,408,699 (GRCm39) splice site probably benign
R0612:Clstn3 UTSW 6 124,426,459 (GRCm39) missense probably damaging 0.98
R1200:Clstn3 UTSW 6 124,436,129 (GRCm39) missense probably damaging 1.00
R1224:Clstn3 UTSW 6 124,434,878 (GRCm39) missense probably benign
R1378:Clstn3 UTSW 6 124,415,378 (GRCm39) missense probably damaging 1.00
R1491:Clstn3 UTSW 6 124,414,449 (GRCm39) missense possibly damaging 0.51
R1495:Clstn3 UTSW 6 124,426,876 (GRCm39) missense probably benign 0.00
R1511:Clstn3 UTSW 6 124,439,128 (GRCm39) missense probably damaging 1.00
R1655:Clstn3 UTSW 6 124,414,386 (GRCm39) missense probably damaging 1.00
R1731:Clstn3 UTSW 6 124,408,591 (GRCm39) missense probably benign 0.04
R1734:Clstn3 UTSW 6 124,413,773 (GRCm39) splice site probably benign
R1751:Clstn3 UTSW 6 124,408,958 (GRCm39) missense probably damaging 1.00
R1954:Clstn3 UTSW 6 124,436,257 (GRCm39) missense possibly damaging 0.94
R2133:Clstn3 UTSW 6 124,426,462 (GRCm39) missense probably benign
R2192:Clstn3 UTSW 6 124,436,166 (GRCm39) missense probably damaging 1.00
R2314:Clstn3 UTSW 6 124,427,676 (GRCm39) missense probably benign 0.39
R2874:Clstn3 UTSW 6 124,415,294 (GRCm39) missense probably damaging 1.00
R3500:Clstn3 UTSW 6 124,408,670 (GRCm39) missense probably benign 0.01
R3761:Clstn3 UTSW 6 124,434,835 (GRCm39) missense possibly damaging 0.54
R3878:Clstn3 UTSW 6 124,434,901 (GRCm39) missense probably damaging 0.97
R3927:Clstn3 UTSW 6 124,428,327 (GRCm39) missense probably damaging 1.00
R3934:Clstn3 UTSW 6 124,434,901 (GRCm39) missense probably damaging 0.97
R3935:Clstn3 UTSW 6 124,434,901 (GRCm39) missense probably damaging 0.97
R4063:Clstn3 UTSW 6 124,426,792 (GRCm39) missense possibly damaging 0.51
R4402:Clstn3 UTSW 6 124,433,939 (GRCm39) missense probably damaging 0.96
R4534:Clstn3 UTSW 6 124,436,179 (GRCm39) missense probably damaging 1.00
R4785:Clstn3 UTSW 6 124,414,331 (GRCm39) splice site probably null
R4834:Clstn3 UTSW 6 124,408,912 (GRCm39) splice site probably null
R5921:Clstn3 UTSW 6 124,408,539 (GRCm39) utr 3 prime probably benign
R5932:Clstn3 UTSW 6 124,415,291 (GRCm39) missense probably benign 0.01
R6025:Clstn3 UTSW 6 124,408,623 (GRCm39) missense possibly damaging 0.73
R6101:Clstn3 UTSW 6 124,438,629 (GRCm39) missense probably damaging 1.00
R6360:Clstn3 UTSW 6 124,415,388 (GRCm39) missense possibly damaging 0.88
R6578:Clstn3 UTSW 6 124,427,663 (GRCm39) critical splice donor site probably null
R6813:Clstn3 UTSW 6 124,413,894 (GRCm39) missense probably benign 0.00
R7380:Clstn3 UTSW 6 124,433,948 (GRCm39) missense probably benign 0.01
R7419:Clstn3 UTSW 6 124,435,088 (GRCm39) missense probably benign 0.05
R7625:Clstn3 UTSW 6 124,414,377 (GRCm39) nonsense probably null
R7780:Clstn3 UTSW 6 124,439,161 (GRCm39) missense probably damaging 0.98
R7936:Clstn3 UTSW 6 124,408,972 (GRCm39) missense possibly damaging 0.73
R7939:Clstn3 UTSW 6 124,439,158 (GRCm39) missense probably damaging 1.00
R8047:Clstn3 UTSW 6 124,408,972 (GRCm39) missense possibly damaging 0.73
R8079:Clstn3 UTSW 6 124,436,763 (GRCm39) missense probably damaging 1.00
R8085:Clstn3 UTSW 6 124,435,683 (GRCm39) missense probably benign 0.23
R8299:Clstn3 UTSW 6 124,414,332 (GRCm39) critical splice donor site probably null
R8406:Clstn3 UTSW 6 124,439,136 (GRCm39) missense probably damaging 1.00
R8685:Clstn3 UTSW 6 124,433,867 (GRCm39) missense probably damaging 1.00
R9045:Clstn3 UTSW 6 124,408,921 (GRCm39) missense probably damaging 0.98
R9209:Clstn3 UTSW 6 124,408,571 (GRCm39) missense probably benign 0.02
R9264:Clstn3 UTSW 6 124,436,727 (GRCm39) missense probably damaging 1.00
R9268:Clstn3 UTSW 6 124,433,880 (GRCm39) missense probably damaging 0.99
R9443:Clstn3 UTSW 6 124,428,358 (GRCm39) missense probably damaging 1.00
RF014:Clstn3 UTSW 6 124,436,225 (GRCm39) nonsense probably null
X0066:Clstn3 UTSW 6 124,426,770 (GRCm39) missense probably benign 0.13
Z1176:Clstn3 UTSW 6 124,436,159 (GRCm39) missense probably damaging 1.00
Z1177:Clstn3 UTSW 6 124,426,740 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGAGAAGAGTCACCTTGCCTAGC -3'
(R):5'- TGCCTGCCCTGTAGATTTTGGAC -3'

Sequencing Primer
(F):5'- GAGTCACCTTGCCTAGCTATACAG -3'
(R):5'- CTATTCCTTGAGCAGAGTAGGCAG -3'
Posted On 2013-06-11