Incidental Mutation 'R0440:Ccar1'
ID46699
Institutional Source Beutler Lab
Gene Symbol Ccar1
Ensembl Gene ENSMUSG00000020074
Gene Namecell division cycle and apoptosis regulator 1
Synonyms9430036H15Rik, Carp1, 2610511G16Rik
MMRRC Submission 038641-MU
Accession Numbers

Genbank: NM_026201.3; Ensembl: ENSMUST00000020268

Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R0440 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location62743928-62792286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62780457 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 165 (V165I)
Ref Sequence ENSEMBL: ENSMUSP00000151895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020268] [ENSMUST00000217768] [ENSMUST00000218229] [ENSMUST00000218946] [ENSMUST00000219527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020268
AA Change: V165I

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020268
Gene: ENSMUSG00000020074
AA Change: V165I

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
low complexity region 62 106 N/A INTRINSIC
Pfam:S1-like 144 201 1.7e-34 PFAM
low complexity region 236 254 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 358 N/A INTRINSIC
DBC1 475 606 4.46e-90 SMART
SAP 633 667 5.25e-9 SMART
Blast:HDc 753 784 1e-7 BLAST
coiled coil region 792 819 N/A INTRINSIC
low complexity region 871 895 N/A INTRINSIC
SCOP:d1hqva_ 898 964 5e-3 SMART
Blast:HDc 921 979 5e-17 BLAST
coiled coil region 1029 1111 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217768
AA Change: V165I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217940
Predicted Effect probably benign
Transcript: ENSMUST00000218229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218355
Predicted Effect probably benign
Transcript: ENSMUST00000218946
Predicted Effect possibly damaging
Transcript: ENSMUST00000219527
AA Change: V165I

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1331 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 99% (68/69)
Allele List at MGI

All alleles(45) : Targeted, other(4) Gene trapped(41)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,228,493 R30W probably damaging Het
Adam7 T C 14: 68,510,856 probably null Het
Agl A T 3: 116,758,806 L1158Q probably damaging Het
Akap9 T C 5: 4,064,569 S66P probably damaging Het
Akr1c20 T A 13: 4,487,208 D316V probably benign Het
App C A 16: 85,056,414 E259* probably null Het
Arhgef4 A G 1: 34,745,448 probably null Het
Armc9 G A 1: 86,194,262 probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Btaf1 C T 19: 36,986,653 P875S probably damaging Het
Cc2d1b T A 4: 108,625,816 probably null Het
Ccdc106 A T 7: 5,060,245 I250F probably damaging Het
Ccny T C 18: 9,332,917 I205V probably benign Het
Cfap52 T A 11: 67,954,088 I52L probably benign Het
Chd8 T A 14: 52,204,826 T2096S possibly damaging Het
Clstn3 G A 6: 124,451,413 T423I probably damaging Het
Col13a1 T C 10: 61,867,483 D440G possibly damaging Het
Dclk3 G A 9: 111,469,163 V592M probably damaging Het
Ddx31 A T 2: 28,857,132 I208F probably damaging Het
Dlat A T 9: 50,645,119 probably null Het
Eml4 T C 17: 83,446,058 probably null Het
Enpp2 T A 15: 54,847,237 probably benign Het
Fryl T C 5: 73,086,972 S38G possibly damaging Het
Gcnt1 G A 19: 17,330,316 T15I probably benign Het
Gm21834 T C 17: 57,742,126 T32A possibly damaging Het
Golga2 A G 2: 32,302,933 D394G probably damaging Het
Gtf3c4 G T 2: 28,840,169 probably null Het
Igkv4-69 A G 6: 69,284,269 probably benign Het
Inpp5j T C 11: 3,501,150 R500G possibly damaging Het
Kif5b A T 18: 6,226,980 probably benign Het
Klhl36 A G 8: 119,876,551 E515G probably damaging Het
Lifr C T 15: 7,157,191 R59* probably null Het
Lrif1 A T 3: 106,734,398 Q10L possibly damaging Het
Lrp8 A G 4: 107,869,098 E908G probably damaging Het
Lrrc23 A T 6: 124,770,704 D307E probably benign Het
Mpv17l T C 16: 13,944,719 F27L probably damaging Het
Mta3 C T 17: 83,766,587 A76V probably damaging Het
Muc5ac T A 7: 141,792,034 Y202* probably null Het
Naprt A G 15: 75,891,069 probably benign Het
Npr2 T A 4: 43,650,315 V960D probably damaging Het
Oca2 A T 7: 56,423,352 Y765F probably benign Het
Olfr715 A T 7: 107,128,732 H220Q probably benign Het
Plxna2 T A 1: 194,644,404 Y215* probably null Het
Prdm16 G A 4: 154,476,627 probably benign Het
Ptn A G 6: 36,744,497 S3P probably benign Het
Pus10 T C 11: 23,673,331 probably benign Het
Rad21 A T 15: 51,968,358 D442E probably benign Het
Rmdn2 A G 17: 79,667,955 H291R probably damaging Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Samd4b A T 7: 28,408,160 I228N probably benign Het
Sdr9c7 G T 10: 127,898,953 probably benign Het
Slc13a2 T C 11: 78,403,175 N254D probably benign Het
Slc16a8 T A 15: 79,252,607 I132F probably damaging Het
Slc18b1 T A 10: 23,819,078 Y274N probably benign Het
Slc45a2 A T 15: 11,000,817 M1L probably benign Het
Smc1b A G 15: 85,112,673 probably benign Het
Stab2 T C 10: 86,949,928 S617G probably benign Het
Stk10 A G 11: 32,604,190 M626V probably damaging Het
Synpo2l T G 14: 20,661,398 I385L possibly damaging Het
Tmprss11d T C 5: 86,338,812 Y73C probably damaging Het
Ttc21b A G 2: 66,236,382 V309A probably benign Het
Tubgcp6 A G 15: 89,103,065 I1235T probably benign Het
Usp8 A G 2: 126,725,390 I110V probably benign Het
Vps13c G A 9: 67,972,861 G3442S probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp207 T A 11: 80,395,507 probably benign Het
Zfp748 A C 13: 67,553,025 probably null Het
Other mutations in Ccar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Ccar1 APN 10 62753234 missense unknown
IGL01291:Ccar1 APN 10 62756649 missense probably damaging 1.00
IGL01364:Ccar1 APN 10 62776874 unclassified probably null
IGL01777:Ccar1 APN 10 62780577 missense possibly damaging 0.71
IGL01958:Ccar1 APN 10 62790935 missense possibly damaging 0.94
IGL03096:Ccar1 APN 10 62764333 missense probably benign 0.20
Lonk UTSW 10 62764533 missense probably damaging 1.00
1mM(1):Ccar1 UTSW 10 62783886 missense probably benign 0.00
ANU05:Ccar1 UTSW 10 62756649 missense probably damaging 1.00
R1295:Ccar1 UTSW 10 62783882 critical splice donor site probably null
R1573:Ccar1 UTSW 10 62750655 missense unknown
R1585:Ccar1 UTSW 10 62751001 missense unknown
R1633:Ccar1 UTSW 10 62751014 missense unknown
R1840:Ccar1 UTSW 10 62763510 missense probably damaging 0.98
R1854:Ccar1 UTSW 10 62764517 missense probably damaging 1.00
R1905:Ccar1 UTSW 10 62776658 missense possibly damaging 0.85
R2011:Ccar1 UTSW 10 62776694 missense probably benign 0.03
R2041:Ccar1 UTSW 10 62766048 missense probably damaging 1.00
R2202:Ccar1 UTSW 10 62745287 missense unknown
R2327:Ccar1 UTSW 10 62764382 missense probably damaging 1.00
R2932:Ccar1 UTSW 10 62776759 missense probably benign 0.08
R3040:Ccar1 UTSW 10 62756494 missense possibly damaging 0.83
R4647:Ccar1 UTSW 10 62747417 nonsense probably null
R4829:Ccar1 UTSW 10 62745335 missense unknown
R4887:Ccar1 UTSW 10 62753218 missense unknown
R4888:Ccar1 UTSW 10 62753218 missense unknown
R5000:Ccar1 UTSW 10 62751005 missense unknown
R5207:Ccar1 UTSW 10 62753281 missense unknown
R5214:Ccar1 UTSW 10 62770961 missense probably damaging 1.00
R5644:Ccar1 UTSW 10 62771978 missense probably benign 0.16
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6063:Ccar1 UTSW 10 62776717 missense possibly damaging 0.70
R6330:Ccar1 UTSW 10 62764533 missense probably damaging 1.00
R6370:Ccar1 UTSW 10 62764529 missense probably damaging 1.00
R6828:Ccar1 UTSW 10 62764430 missense probably damaging 0.98
R6943:Ccar1 UTSW 10 62746936 missense unknown
V8831:Ccar1 UTSW 10 62747406 missense unknown
X0017:Ccar1 UTSW 10 62765340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTGTCACCTAACTGACAAAACATT -3'
(R):5'- GCATTGCCCACAAGCCTTAGCC -3'

Sequencing Primer
(F):5'- aaaaccaactcccacctttaac -3'
(R):5'- ACAAGCCTTAGCCTGTCG -3'
Posted On2013-06-11