Mutagenetix > Incidental Mutation

Incidental Mutation 'R0440:Stab2'

46700

Institutional Source

Beutler Lab

Gene Symbol

Stab2

Ensembl Gene

ENSMUSG00000035459

Gene Name

stabilin 2

Synonyms

STAB-2, FEEL-2

MMRRC Submission

038641-MU

Accession Numbers

Genbank: NM_138673; MGI: 2178743

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0440 (G1)

Quality Score

169

Status

Validated (trace)

Chromosome

Chromosomal Location

86841198-87008025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86949928 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 617 (S617G)

Ref Sequence

ENSEMBL: ENSMUSP00000048309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035288]

AlphaFold

Q8R4U0

Predicted Effect

probably benign
Transcript: ENSMUST00000035288
AA Change: S617G

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: S617G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EGF	119	156	1.85e0	SMART
EGF	167	201	2.43e1	SMART
EGF	206	244	1.43e-1	SMART
EGF	248	284	3.82e-2	SMART
EGF	333	370	2.02e-1	SMART
FAS1	414	515	1.06e-8	SMART
FAS1	561	662	3.54e-19	SMART
EGF	746	783	6.76e-3	SMART
EGF	836	873	1.31e0	SMART
EGF	877	917	2.99e-4	SMART
EGF	921	960	3.51e-1	SMART
EGF	964	1002	1.99e0	SMART
FAS1	1038	1138	1.73e-13	SMART
FAS1	1181	1276	1.83e-12	SMART
EGF	1354	1391	6.92e0	SMART
EGF	1401	1435	1.11e1	SMART
EGF	1442	1477	3.01e0	SMART
EGF	1481	1519	1.64e-1	SMART
EGF	1523	1561	1.14e0	SMART
EGF	1565	1603	5.62e0	SMART
FAS1	1638	1734	2.23e-25	SMART
FAS1	1785	1891	6.92e-22	SMART
EGF	1966	2006	1.95e1	SMART
EGF_like	1977	2017	2.46e-1	SMART
EGF	2016	2050	1.14e0	SMART
EGF	2058	2089	1.56e1	SMART
EGF	2093	2130	1.36e1	SMART
EGF	2134	2173	2.13e0	SMART
LINK	2204	2298	2.08e-29	SMART
FAS1	2363	2455	3.19e-12	SMART
transmembrane domain	2467	2489	N/A	INTRINSIC

Meta Mutation Damage Score

0.1552

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 97.0%
20x: 94.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4galt	G	A	15: 83,228,493	R30W	probably damaging	Het
Adam7	T	C	14: 68,510,856		probably null	Het
Agl	A	T	3: 116,758,806	L1158Q	probably damaging	Het
Akap9	T	C	5: 4,064,569	S66P	probably damaging	Het
Akr1c20	T	A	13: 4,487,208	D316V	probably benign	Het
App	C	A	16: 85,056,414	E259*	probably null	Het
Arhgef4	A	G	1: 34,745,448		probably null	Het
Armc9	G	A	1: 86,194,262		probably null	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Btaf1	C	T	19: 36,986,653	P875S	probably damaging	Het
Cc2d1b	T	A	4: 108,625,816		probably null	Het
Ccar1	C	T	10: 62,780,457	V165I	possibly damaging	Het
Ccdc106	A	T	7: 5,060,245	I250F	probably damaging	Het
Ccny	T	C	18: 9,332,917	I205V	probably benign	Het
Cfap52	T	A	11: 67,954,088	I52L	probably benign	Het
Chd8	T	A	14: 52,204,826	T2096S	possibly damaging	Het
Clstn3	G	A	6: 124,451,413	T423I	probably damaging	Het
Col13a1	T	C	10: 61,867,483	D440G	possibly damaging	Het
Dclk3	G	A	9: 111,469,163	V592M	probably damaging	Het
Ddx31	A	T	2: 28,857,132	I208F	probably damaging	Het
Dlat	A	T	9: 50,645,119		probably null	Het
Eml4	T	C	17: 83,446,058		probably null	Het
Enpp2	T	A	15: 54,847,237		probably benign	Het
Fryl	T	C	5: 73,086,972	S38G	possibly damaging	Het
Gcnt1	G	A	19: 17,330,316	T15I	probably benign	Het
Gm21834	T	C	17: 57,742,126	T32A	possibly damaging	Het
Golga2	A	G	2: 32,302,933	D394G	probably damaging	Het
Gtf3c4	G	T	2: 28,840,169		probably null	Het
Igkv4-69	A	G	6: 69,284,269		probably benign	Het
Inpp5j	T	C	11: 3,501,150	R500G	possibly damaging	Het
Kif5b	A	T	18: 6,226,980		probably benign	Het
Klhl36	A	G	8: 119,876,551	E515G	probably damaging	Het
Lifr	C	T	15: 7,157,191	R59*	probably null	Het
Lrif1	A	T	3: 106,734,398	Q10L	possibly damaging	Het
Lrp8	A	G	4: 107,869,098	E908G	probably damaging	Het
Lrrc23	A	T	6: 124,770,704	D307E	probably benign	Het
Mpv17l	T	C	16: 13,944,719	F27L	probably damaging	Het
Mta3	C	T	17: 83,766,587	A76V	probably damaging	Het
Muc5ac	T	A	7: 141,792,034	Y202*	probably null	Het
Naprt	A	G	15: 75,891,069		probably benign	Het
Npr2	T	A	4: 43,650,315	V960D	probably damaging	Het
Oca2	A	T	7: 56,423,352	Y765F	probably benign	Het
Olfr715	A	T	7: 107,128,732	H220Q	probably benign	Het
Plxna2	T	A	1: 194,644,404	Y215*	probably null	Het
Prdm16	G	A	4: 154,476,627		probably benign	Het
Ptn	A	G	6: 36,744,497	S3P	probably benign	Het
Pus10	T	C	11: 23,673,331		probably benign	Het
Rad21	A	T	15: 51,968,358	D442E	probably benign	Het
Rmdn2	A	G	17: 79,667,955	H291R	probably damaging	Het
Rp1	A	G	1: 4,345,640	S1750P	probably damaging	Het
Samd4b	A	T	7: 28,408,160	I228N	probably benign	Het
Sdr9c7	G	T	10: 127,898,953		probably benign	Het
Slc13a2	T	C	11: 78,403,175	N254D	probably benign	Het
Slc16a8	T	A	15: 79,252,607	I132F	probably damaging	Het
Slc18b1	T	A	10: 23,819,078	Y274N	probably benign	Het
Slc45a2	A	T	15: 11,000,817	M1L	probably benign	Het
Smc1b	A	G	15: 85,112,673		probably benign	Het
Stk10	A	G	11: 32,604,190	M626V	probably damaging	Het
Synpo2l	T	G	14: 20,661,398	I385L	possibly damaging	Het
Tmprss11d	T	C	5: 86,338,812	Y73C	probably damaging	Het
Ttc21b	A	G	2: 66,236,382	V309A	probably benign	Het
Tubgcp6	A	G	15: 89,103,065	I1235T	probably benign	Het
Usp8	A	G	2: 126,725,390	I110V	probably benign	Het
Vps13c	G	A	9: 67,972,861	G3442S	probably damaging	Het
Wdr59	GGGTGGTG	GGGTG	8: 111,480,540		probably benign	Het
Zfp207	T	A	11: 80,395,507		probably benign	Het
Zfp748	A	C	13: 67,553,025		probably null	Het

Other mutations in Stab2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Stab2	APN	10	86869206	splice site	probably null
IGL00809:Stab2	APN	10	86848174	splice site	probably benign
IGL00911:Stab2	APN	10	86969753	missense	probably damaging	1.00
IGL01347:Stab2	APN	10	86901703	splice site	probably null
IGL01411:Stab2	APN	10	86980008	splice site	probably benign
IGL01503:Stab2	APN	10	86940613	splice site	probably benign
IGL01599:Stab2	APN	10	86922895	missense	probably damaging	1.00
IGL01635:Stab2	APN	10	86981128	missense	probably benign	0.04
IGL01640:Stab2	APN	10	86954171	missense	probably benign	0.09
IGL01671:Stab2	APN	10	86969277	missense	possibly damaging	0.80
IGL02023:Stab2	APN	10	86871831	missense	possibly damaging	0.67
IGL02075:Stab2	APN	10	86967650	missense	possibly damaging	0.71
IGL02174:Stab2	APN	10	86859742	splice site	probably null
IGL02600:Stab2	APN	10	86954259	missense	probably damaging	1.00
IGL02666:Stab2	APN	10	86850902	missense	possibly damaging	0.67
IGL02668:Stab2	APN	10	86846163	splice site	probably benign
IGL02709:Stab2	APN	10	86846165	splice site	probably benign
IGL02728:Stab2	APN	10	86856556	missense	possibly damaging	0.95
IGL02803:Stab2	APN	10	86950269	splice site	probably benign
IGL02938:Stab2	APN	10	86871921	missense	possibly damaging	0.77
IGL03033:Stab2	APN	10	86996803	critical splice donor site	probably null
IGL03238:Stab2	APN	10	86855121	missense	probably damaging	1.00
IGL03402:Stab2	APN	10	86969301	missense	probably benign	0.03
prospector	UTSW	10	86901567	splice site	probably null
songbird	UTSW	10	86858152	missense	probably damaging	1.00
3-1:Stab2	UTSW	10	86869177	missense	probably damaging	0.96
F6893:Stab2	UTSW	10	86855171	missense	probably damaging	1.00
K7371:Stab2	UTSW	10	86943289	critical splice donor site	probably null
PIT4142001:Stab2	UTSW	10	86867175	missense	possibly damaging	0.94
PIT4362001:Stab2	UTSW	10	86861435	nonsense	probably null
R0015:Stab2	UTSW	10	86843617	missense	probably benign
R0254:Stab2	UTSW	10	86897960	missense	probably benign
R0310:Stab2	UTSW	10	86967613	splice site	probably benign
R0333:Stab2	UTSW	10	86841627	missense	probably benign
R0391:Stab2	UTSW	10	86947144	missense	probably benign	0.27
R0400:Stab2	UTSW	10	86872610	missense	probably damaging	1.00
R0433:Stab2	UTSW	10	86843491	splice site	probably benign
R0743:Stab2	UTSW	10	86887895	missense	probably damaging	1.00
R0847:Stab2	UTSW	10	86969871	missense	probably benign	0.00
R0883:Stab2	UTSW	10	86924450	splice site	probably benign
R1078:Stab2	UTSW	10	86907133	splice site	probably null
R1118:Stab2	UTSW	10	86885718	splice site	probably null
R1119:Stab2	UTSW	10	86859755	missense	possibly damaging	0.51
R1179:Stab2	UTSW	10	86950301	missense	probably damaging	0.98
R1440:Stab2	UTSW	10	86861367	splice site	probably null
R1550:Stab2	UTSW	10	86878926	missense	probably benign	0.01
R1616:Stab2	UTSW	10	86885718	splice site	probably null
R1728:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1768:Stab2	UTSW	10	87003008	missense	probably damaging	1.00
R1772:Stab2	UTSW	10	86954234	missense	probably benign	0.06
R1776:Stab2	UTSW	10	86957816	missense	possibly damaging	0.92
R1784:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1892:Stab2	UTSW	10	86938049	missense	probably damaging	0.99
R1957:Stab2	UTSW	10	86861470	missense	probably benign	0.13
R1972:Stab2	UTSW	10	86960316	missense	probably damaging	0.99
R1975:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1976:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1996:Stab2	UTSW	10	87003031	missense	probably damaging	1.00
R2085:Stab2	UTSW	10	86954159	missense	probably damaging	1.00
R2149:Stab2	UTSW	10	86865040	nonsense	probably null
R2169:Stab2	UTSW	10	86887862	missense	probably damaging	1.00
R2201:Stab2	UTSW	10	86940639	missense	probably benign	0.22
R2296:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2297:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2298:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2326:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2434:Stab2	UTSW	10	86969319	missense	possibly damaging	0.78
R2519:Stab2	UTSW	10	86934840	splice site	probably benign
R2696:Stab2	UTSW	10	86861499	missense	probably benign	0.45
R2883:Stab2	UTSW	10	86967686	missense	possibly damaging	0.92
R2923:Stab2	UTSW	10	86861461	missense	probably damaging	1.00
R3711:Stab2	UTSW	10	86866708	missense	probably damaging	1.00
R3787:Stab2	UTSW	10	86969277	missense	possibly damaging	0.50
R3834:Stab2	UTSW	10	86949912	missense	possibly damaging	0.87
R3970:Stab2	UTSW	10	86878886	missense	probably damaging	0.97
R3979:Stab2	UTSW	10	86863456	missense	possibly damaging	0.56
R4003:Stab2	UTSW	10	86858124	missense	probably damaging	1.00
R4088:Stab2	UTSW	10	86922185	missense	probably damaging	1.00
R4151:Stab2	UTSW	10	87002983	missense	probably benign	0.12
R4190:Stab2	UTSW	10	86878944	missense	probably damaging	0.98
R4556:Stab2	UTSW	10	86967679	missense	possibly damaging	0.95
R4773:Stab2	UTSW	10	86907371	nonsense	probably null
R4825:Stab2	UTSW	10	86947147	missense	probably benign	0.08
R4865:Stab2	UTSW	10	86843500	splice site	probably null
R4871:Stab2	UTSW	10	86942235	missense	probably damaging	0.99
R4943:Stab2	UTSW	10	86954162	missense	probably damaging	0.99
R4981:Stab2	UTSW	10	86960223	missense	probably benign
R4994:Stab2	UTSW	10	86949907	missense	probably benign
R4999:Stab2	UTSW	10	86937909	missense	probably damaging	0.97
R5061:Stab2	UTSW	10	86907385	missense	probably damaging	1.00
R5072:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5073:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5074:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5134:Stab2	UTSW	10	86871810	splice site	probably null
R5213:Stab2	UTSW	10	86907197	missense	probably damaging	0.99
R5508:Stab2	UTSW	10	86960279	missense	probably benign	0.01
R5530:Stab2	UTSW	10	86947162	missense	probably benign	0.04
R5540:Stab2	UTSW	10	86848125	missense	probably benign	0.30
R5839:Stab2	UTSW	10	86872691	missense	probably damaging	0.97
R5949:Stab2	UTSW	10	86969849	missense	possibly damaging	0.87
R6015:Stab2	UTSW	10	86938042	missense	probably damaging	0.99
R6019:Stab2	UTSW	10	87003022	missense	probably benign	0.00
R6116:Stab2	UTSW	10	86907190	missense	probably damaging	1.00
R6131:Stab2	UTSW	10	86883778	splice site	probably null
R6209:Stab2	UTSW	10	86923003	missense	possibly damaging	0.94
R6243:Stab2	UTSW	10	86907161	missense	probably damaging	1.00
R6433:Stab2	UTSW	10	86901567	splice site	probably null
R6787:Stab2	UTSW	10	86919084	missense	probably benign	0.07
R6841:Stab2	UTSW	10	86942190	missense	probably damaging	1.00
R6873:Stab2	UTSW	10	86861366	critical splice donor site	probably null
R7025:Stab2	UTSW	10	86850837	missense	probably damaging	1.00
R7043:Stab2	UTSW	10	86870246	missense	probably damaging	0.99
R7047:Stab2	UTSW	10	86858152	missense	probably damaging	1.00
R7107:Stab2	UTSW	10	86905592	missense	possibly damaging	0.96
R7214:Stab2	UTSW	10	86899841	missense	probably damaging	0.99
R7271:Stab2	UTSW	10	87003108	splice site	probably null
R7291:Stab2	UTSW	10	86946220	missense	probably damaging	0.96
R7336:Stab2	UTSW	10	86969185	nonsense	probably null
R7432:Stab2	UTSW	10	86885683	missense	probably damaging	0.99
R7580:Stab2	UTSW	10	86869164	missense	probably benign	0.00
R7622:Stab2	UTSW	10	86873902	missense	possibly damaging	0.65
R7629:Stab2	UTSW	10	86883782	critical splice donor site	probably null
R7658:Stab2	UTSW	10	86981135	missense	probably benign	0.12
R7798:Stab2	UTSW	10	86957912	missense	probably damaging	0.98
R7835:Stab2	UTSW	10	86872619	missense	probably benign	0.06
R7845:Stab2	UTSW	10	86996894	missense	probably benign	0.09
R7863:Stab2	UTSW	10	86972881	missense	probably benign	0.30
R7885:Stab2	UTSW	10	86878912	missense	probably benign	0.03
R7904:Stab2	UTSW	10	86954192	nonsense	probably null
R7947:Stab2	UTSW	10	86846033	missense	probably benign	0.31
R7963:Stab2	UTSW	10	86848023	critical splice donor site	probably null
R8014:Stab2	UTSW	10	86850903	missense	possibly damaging	0.78
R8021:Stab2	UTSW	10	86905539	missense	possibly damaging	0.69
R8024:Stab2	UTSW	10	86846052	missense	probably benign	0.34
R8097:Stab2	UTSW	10	86869095	missense	possibly damaging	0.86
R8281:Stab2	UTSW	10	86873864	missense	probably damaging	0.98
R8462:Stab2	UTSW	10	86967734	missense	possibly damaging	0.79
R8670:Stab2	UTSW	10	86940723	missense	probably damaging	1.00
R8692:Stab2	UTSW	10	86972930	missense	probably damaging	0.99
R8744:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8745:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8782:Stab2	UTSW	10	86899821	missense	probably benign	0.00
R8875:Stab2	UTSW	10	86996864	missense	probably damaging	1.00
R8978:Stab2	UTSW	10	86949918	missense	possibly damaging	0.64
R9141:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9248:Stab2	UTSW	10	86891617	missense	probably damaging	0.98
R9326:Stab2	UTSW	10	86955146	missense	probably damaging	1.00
R9426:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9568:Stab2	UTSW	10	86863556	missense	probably damaging	1.00
R9627:Stab2	UTSW	10	86957840	missense	probably damaging	0.98
R9635:Stab2	UTSW	10	86850787	nonsense	probably null
R9648:Stab2	UTSW	10	86856697	frame shift	probably null
R9649:Stab2	UTSW	10	86856697	frame shift	probably null
R9650:Stab2	UTSW	10	86856697	frame shift	probably null
R9726:Stab2	UTSW	10	86954231	missense	probably benign	0.00
R9756:Stab2	UTSW	10	86967689	missense	possibly damaging	0.50
R9786:Stab2	UTSW	10	86922133	missense	probably benign	0.03
RF061:Stab2	UTSW	10	86866758	critical splice acceptor site	probably benign
X0023:Stab2	UTSW	10	86922198	critical splice acceptor site	probably null
X0025:Stab2	UTSW	10	86887816	missense	probably damaging	1.00
Z1176:Stab2	UTSW	10	86949914	missense	probably damaging	0.99
Z1177:Stab2	UTSW	10	86896596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACAGGAGCATTCCTACAGATGTTACC -3'
(R):5'- GGCACTTATTAGCTCTGAGCAGACC -3'

Sequencing Primer
(F):5'- CATTCCTACAGATGTTACCTAACAAG -3'
(R):5'- TGAGCAGACCTTCAGTCTGTAAC -3'

Posted On

2013-06-11