Incidental Mutation 'R0440:Pus10'
ID46703
Institutional Source Beutler Lab
Gene Symbol Pus10
Ensembl Gene ENSMUSG00000020280
Gene Namepseudouridylate synthase 10
SynonymsCcdc139, 4933435A13Rik, 2810013G11Rik
MMRRC Submission 038641-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0440 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location23665674-23732876 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 23673331 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020520] [ENSMUST00000058163] [ENSMUST00000109525] [ENSMUST00000143117]
Predicted Effect probably benign
Transcript: ENSMUST00000020520
SMART Domains Protein: ENSMUSP00000020520
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000058163
SMART Domains Protein: ENSMUSP00000050395
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109525
SMART Domains Protein: ENSMUSP00000105151
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136365
Predicted Effect probably benign
Transcript: ENSMUST00000143117
SMART Domains Protein: ENSMUSP00000117934
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 140 4e-65 PDB
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pseudouridination, the isomerization of uridine to pseudouridine, is the most common posttranscriptional nucleotide modification found in RNA and is essential for biologic functions such as spliceosome biogenesis. Pseudouridylate synthases, such as PUS10, catalyze pseudouridination of structural RNAs, including transfer, ribosomal, and splicing RNAs. These enzymes also act as RNA chaperones, facilitating the correct folding and assembly of tRNAs (McCleverty et al., 2007 [PubMed 17900615]).[supplied by OMIM, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,228,493 R30W probably damaging Het
Adam7 T C 14: 68,510,856 probably null Het
Agl A T 3: 116,758,806 L1158Q probably damaging Het
Akap9 T C 5: 4,064,569 S66P probably damaging Het
Akr1c20 T A 13: 4,487,208 D316V probably benign Het
App C A 16: 85,056,414 E259* probably null Het
Arhgef4 A G 1: 34,745,448 probably null Het
Armc9 G A 1: 86,194,262 probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Btaf1 C T 19: 36,986,653 P875S probably damaging Het
Cc2d1b T A 4: 108,625,816 probably null Het
Ccar1 C T 10: 62,780,457 V165I possibly damaging Het
Ccdc106 A T 7: 5,060,245 I250F probably damaging Het
Ccny T C 18: 9,332,917 I205V probably benign Het
Cfap52 T A 11: 67,954,088 I52L probably benign Het
Chd8 T A 14: 52,204,826 T2096S possibly damaging Het
Clstn3 G A 6: 124,451,413 T423I probably damaging Het
Col13a1 T C 10: 61,867,483 D440G possibly damaging Het
Dclk3 G A 9: 111,469,163 V592M probably damaging Het
Ddx31 A T 2: 28,857,132 I208F probably damaging Het
Dlat A T 9: 50,645,119 probably null Het
Eml4 T C 17: 83,446,058 probably null Het
Enpp2 T A 15: 54,847,237 probably benign Het
Fryl T C 5: 73,086,972 S38G possibly damaging Het
Gcnt1 G A 19: 17,330,316 T15I probably benign Het
Gm21834 T C 17: 57,742,126 T32A possibly damaging Het
Golga2 A G 2: 32,302,933 D394G probably damaging Het
Gtf3c4 G T 2: 28,840,169 probably null Het
Igkv4-69 A G 6: 69,284,269 probably benign Het
Inpp5j T C 11: 3,501,150 R500G possibly damaging Het
Kif5b A T 18: 6,226,980 probably benign Het
Klhl36 A G 8: 119,876,551 E515G probably damaging Het
Lifr C T 15: 7,157,191 R59* probably null Het
Lrif1 A T 3: 106,734,398 Q10L possibly damaging Het
Lrp8 A G 4: 107,869,098 E908G probably damaging Het
Lrrc23 A T 6: 124,770,704 D307E probably benign Het
Mpv17l T C 16: 13,944,719 F27L probably damaging Het
Mta3 C T 17: 83,766,587 A76V probably damaging Het
Muc5ac T A 7: 141,792,034 Y202* probably null Het
Naprt A G 15: 75,891,069 probably benign Het
Npr2 T A 4: 43,650,315 V960D probably damaging Het
Oca2 A T 7: 56,423,352 Y765F probably benign Het
Olfr715 A T 7: 107,128,732 H220Q probably benign Het
Plxna2 T A 1: 194,644,404 Y215* probably null Het
Prdm16 G A 4: 154,476,627 probably benign Het
Ptn A G 6: 36,744,497 S3P probably benign Het
Rad21 A T 15: 51,968,358 D442E probably benign Het
Rmdn2 A G 17: 79,667,955 H291R probably damaging Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Samd4b A T 7: 28,408,160 I228N probably benign Het
Sdr9c7 G T 10: 127,898,953 probably benign Het
Slc13a2 T C 11: 78,403,175 N254D probably benign Het
Slc16a8 T A 15: 79,252,607 I132F probably damaging Het
Slc18b1 T A 10: 23,819,078 Y274N probably benign Het
Slc45a2 A T 15: 11,000,817 M1L probably benign Het
Smc1b A G 15: 85,112,673 probably benign Het
Stab2 T C 10: 86,949,928 S617G probably benign Het
Stk10 A G 11: 32,604,190 M626V probably damaging Het
Synpo2l T G 14: 20,661,398 I385L possibly damaging Het
Tmprss11d T C 5: 86,338,812 Y73C probably damaging Het
Ttc21b A G 2: 66,236,382 V309A probably benign Het
Tubgcp6 A G 15: 89,103,065 I1235T probably benign Het
Usp8 A G 2: 126,725,390 I110V probably benign Het
Vps13c G A 9: 67,972,861 G3442S probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp207 T A 11: 80,395,507 probably benign Het
Zfp748 A C 13: 67,553,025 probably null Het
Other mutations in Pus10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pus10 APN 11 23707548 nonsense probably null
IGL02304:Pus10 APN 11 23712275 missense probably damaging 1.00
IGL02466:Pus10 APN 11 23725574 missense probably damaging 0.99
IGL02967:Pus10 APN 11 23718602 missense probably damaging 1.00
IGL03233:Pus10 APN 11 23712241 missense probably damaging 1.00
IGL03300:Pus10 APN 11 23731368 utr 3 prime probably benign
PIT4486001:Pus10 UTSW 11 23712326 critical splice donor site probably null
PIT4677001:Pus10 UTSW 11 23720171 missense possibly damaging 0.88
R0166:Pus10 UTSW 11 23667358 missense probably damaging 1.00
R0519:Pus10 UTSW 11 23711201 missense probably benign 0.02
R1583:Pus10 UTSW 11 23673239 missense probably damaging 0.96
R1714:Pus10 UTSW 11 23725542 missense probably damaging 1.00
R1941:Pus10 UTSW 11 23711198 missense possibly damaging 0.60
R3687:Pus10 UTSW 11 23667334 missense probably benign
R3688:Pus10 UTSW 11 23667334 missense probably benign
R3854:Pus10 UTSW 11 23703003 critical splice donor site probably null
R4064:Pus10 UTSW 11 23728983 missense probably damaging 1.00
R4127:Pus10 UTSW 11 23718654 critical splice donor site probably null
R4276:Pus10 UTSW 11 23706895 missense probably damaging 1.00
R4655:Pus10 UTSW 11 23672707 missense probably benign 0.02
R5302:Pus10 UTSW 11 23667416 critical splice donor site probably null
R5580:Pus10 UTSW 11 23672556 missense probably benign 0.16
R6196:Pus10 UTSW 11 23672638 missense probably benign 0.15
R6549:Pus10 UTSW 11 23729075 critical splice donor site probably null
R6722:Pus10 UTSW 11 23702975 missense possibly damaging 0.93
R6724:Pus10 UTSW 11 23729037 missense possibly damaging 0.78
X0064:Pus10 UTSW 11 23708743 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTTGACCTGAAACTGCCAGTTGTG -3'
(R):5'- GGATGGCCTCAAATTCCTTGCCAC -3'

Sequencing Primer
(F):5'- GCCCTAGCTCTGAACTGAATG -3'
(R):5'- AATTCCTTGCCACCCCGC -3'
Posted On2013-06-11