Incidental Mutation 'R0440:Gcnt1'
ID46728
Institutional Source Beutler Lab
Gene Symbol Gcnt1
Ensembl Gene ENSMUSG00000038843
Gene Nameglucosaminyl (N-acetyl) transferase 1, core 2
SynonymsC2 GlcNAcT, 5630400D21Rik, IGnT, beta-1, 6-N-acetylglucosaminyltransferase
MMRRC Submission 038641-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0440 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location17326141-17356667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17330316 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 15 (T15I)
Ref Sequence ENSEMBL: ENSMUSP00000133935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169897] [ENSMUST00000174236]
PDB Structure
X-ray crystal structure of murine leukocyte-type Core 2 b1,6-N-acetylglucosaminyltransferase (C2GnT-L) [X-RAY DIFFRACTION]
X-ray crystal structure of murine leukocyte-type Core 2 b1,6-N-acetylglucosaminyltransferase (C2GnT-L) in complex with Galb1,3GalNAc [X-RAY DIFFRACTION]
Structure and mechanisim of core 2 beta1,6-n-acetylglucosaminyltransferase: a Metal-ion independent gt-a glycosyltransferase [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000169897
AA Change: T15I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127835
Gene: ENSMUSG00000038843
AA Change: T15I

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
Pfam:Branch 123 392 9.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174137
Predicted Effect probably benign
Transcript: ENSMUST00000174236
AA Change: T15I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133935
Gene: ENSMUSG00000038843
AA Change: T15I

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Branch 127 396 5.7e-65 PFAM
Meta Mutation Damage Score 0.0771 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,6-N-acetylglucosaminyltransferase gene family. It is essential to the formation of Gal beta 1-3(GlcNAc beta 1-6)GalNAc structures and the core 2 O-glycan branch. The gene coding this enzyme was originally mapped to 9q21, but was later localized to 9q13. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele display a grossly normal phenotype and are fertile. There are abnormalities in white blood cell counts and in inflammatory response however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,228,493 R30W probably damaging Het
Adam7 T C 14: 68,510,856 probably null Het
Agl A T 3: 116,758,806 L1158Q probably damaging Het
Akap9 T C 5: 4,064,569 S66P probably damaging Het
Akr1c20 T A 13: 4,487,208 D316V probably benign Het
App C A 16: 85,056,414 E259* probably null Het
Arhgef4 A G 1: 34,745,448 probably null Het
Armc9 G A 1: 86,194,262 probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Btaf1 C T 19: 36,986,653 P875S probably damaging Het
Cc2d1b T A 4: 108,625,816 probably null Het
Ccar1 C T 10: 62,780,457 V165I possibly damaging Het
Ccdc106 A T 7: 5,060,245 I250F probably damaging Het
Ccny T C 18: 9,332,917 I205V probably benign Het
Cfap52 T A 11: 67,954,088 I52L probably benign Het
Chd8 T A 14: 52,204,826 T2096S possibly damaging Het
Clstn3 G A 6: 124,451,413 T423I probably damaging Het
Col13a1 T C 10: 61,867,483 D440G possibly damaging Het
Dclk3 G A 9: 111,469,163 V592M probably damaging Het
Ddx31 A T 2: 28,857,132 I208F probably damaging Het
Dlat A T 9: 50,645,119 probably null Het
Eml4 T C 17: 83,446,058 probably null Het
Enpp2 T A 15: 54,847,237 probably benign Het
Fryl T C 5: 73,086,972 S38G possibly damaging Het
Gm21834 T C 17: 57,742,126 T32A possibly damaging Het
Golga2 A G 2: 32,302,933 D394G probably damaging Het
Gtf3c4 G T 2: 28,840,169 probably null Het
Igkv4-69 A G 6: 69,284,269 probably benign Het
Inpp5j T C 11: 3,501,150 R500G possibly damaging Het
Kif5b A T 18: 6,226,980 probably benign Het
Klhl36 A G 8: 119,876,551 E515G probably damaging Het
Lifr C T 15: 7,157,191 R59* probably null Het
Lrif1 A T 3: 106,734,398 Q10L possibly damaging Het
Lrp8 A G 4: 107,869,098 E908G probably damaging Het
Lrrc23 A T 6: 124,770,704 D307E probably benign Het
Mpv17l T C 16: 13,944,719 F27L probably damaging Het
Mta3 C T 17: 83,766,587 A76V probably damaging Het
Muc5ac T A 7: 141,792,034 Y202* probably null Het
Naprt A G 15: 75,891,069 probably benign Het
Npr2 T A 4: 43,650,315 V960D probably damaging Het
Oca2 A T 7: 56,423,352 Y765F probably benign Het
Olfr715 A T 7: 107,128,732 H220Q probably benign Het
Plxna2 T A 1: 194,644,404 Y215* probably null Het
Prdm16 G A 4: 154,476,627 probably benign Het
Ptn A G 6: 36,744,497 S3P probably benign Het
Pus10 T C 11: 23,673,331 probably benign Het
Rad21 A T 15: 51,968,358 D442E probably benign Het
Rmdn2 A G 17: 79,667,955 H291R probably damaging Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Samd4b A T 7: 28,408,160 I228N probably benign Het
Sdr9c7 G T 10: 127,898,953 probably benign Het
Slc13a2 T C 11: 78,403,175 N254D probably benign Het
Slc16a8 T A 15: 79,252,607 I132F probably damaging Het
Slc18b1 T A 10: 23,819,078 Y274N probably benign Het
Slc45a2 A T 15: 11,000,817 M1L probably benign Het
Smc1b A G 15: 85,112,673 probably benign Het
Stab2 T C 10: 86,949,928 S617G probably benign Het
Stk10 A G 11: 32,604,190 M626V probably damaging Het
Synpo2l T G 14: 20,661,398 I385L possibly damaging Het
Tmprss11d T C 5: 86,338,812 Y73C probably damaging Het
Ttc21b A G 2: 66,236,382 V309A probably benign Het
Tubgcp6 A G 15: 89,103,065 I1235T probably benign Het
Usp8 A G 2: 126,725,390 I110V probably benign Het
Vps13c G A 9: 67,972,861 G3442S probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp207 T A 11: 80,395,507 probably benign Het
Zfp748 A C 13: 67,553,025 probably null Het
Other mutations in Gcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02700:Gcnt1 APN 19 17329416 missense probably damaging 1.00
IGL02836:Gcnt1 APN 19 17330129 missense probably benign
IGL02977:Gcnt1 APN 19 17329374 missense probably damaging 1.00
IGL03302:Gcnt1 APN 19 17329183 missense probably benign 0.25
magenta UTSW 19 17329404 missense probably damaging 1.00
Violet UTSW 19 17329359 missense probably damaging 1.00
R0183:Gcnt1 UTSW 19 17329117 missense probably benign 0.23
R1159:Gcnt1 UTSW 19 17329804 missense possibly damaging 0.90
R1523:Gcnt1 UTSW 19 17329833 missense probably damaging 1.00
R2240:Gcnt1 UTSW 19 17329331 missense possibly damaging 0.91
R4510:Gcnt1 UTSW 19 17330277 missense probably benign 0.00
R4511:Gcnt1 UTSW 19 17330277 missense probably benign 0.00
R5689:Gcnt1 UTSW 19 17329404 missense probably damaging 1.00
R7765:Gcnt1 UTSW 19 17329359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGATGAAAGAGGCACAGTCACG -3'
(R):5'- CCGCTGTTAAACTGGCATCTCACC -3'

Sequencing Primer
(F):5'- CAGTCACGGGTCATGTTTATATAGTC -3'
(R):5'- AAGTTTGTCCCACCACACCA -3'
Posted On2013-06-11