Incidental Mutation 'R0471:Washc4'
ID46768
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
MMRRC Submission 038671-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R0471 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 83558734 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect probably benign
Transcript: ENSMUST00000038388
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik G A 4: 35,193,257 T232I probably benign Het
Acp6 T C 3: 97,168,575 probably null Het
Adam33 C A 2: 131,054,479 G437C probably damaging Het
Aldh1a1 T A 19: 20,602,013 M1K probably null Het
Amotl2 C A 9: 102,720,519 P126Q probably damaging Het
Ap1g1 T A 8: 109,853,643 M576K possibly damaging Het
Apob C A 12: 7,990,406 A581E probably damaging Het
Asb7 A T 7: 66,679,159 D44E probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc65 A T 15: 98,717,467 H118L probably benign Het
Cdc25b A G 2: 131,197,284 E523G probably damaging Het
Cdk11b A G 4: 155,647,542 probably benign Het
Clec1b A G 6: 129,401,607 probably benign Het
Cntrl A G 2: 35,127,380 T400A probably benign Het
Cpne4 T G 9: 105,022,282 probably null Het
Cyp2j6 T A 4: 96,531,748 R249* probably null Het
Dock2 T C 11: 34,688,553 I678V probably benign Het
Dqx1 C T 6: 83,059,426 probably benign Het
Dsp A T 13: 38,193,350 K1704* probably null Het
Eif2b2 T C 12: 85,220,183 F121S probably benign Het
Ephx4 T C 5: 107,413,513 V69A possibly damaging Het
Epn2 T C 11: 61,535,308 Q281R probably damaging Het
Fgf3 A C 7: 144,842,810 D187A probably damaging Het
Galnt18 C A 7: 111,779,299 probably benign Het
Gm4871 C T 5: 145,031,592 probably benign Het
Ick G T 9: 78,155,517 probably null Het
Inpp4b T C 8: 82,041,899 I679T possibly damaging Het
Itpkb A G 1: 180,418,255 E779G probably damaging Het
Itsn1 G A 16: 91,899,589 V27M probably damaging Het
Lrp2 C A 2: 69,525,234 R422L probably damaging Het
Mmp25 G A 17: 23,639,884 A231V possibly damaging Het
Mprip T C 11: 59,759,735 S1422P probably damaging Het
Mro A T 18: 73,876,789 Q176L probably benign Het
Mrpl12 A G 11: 120,488,403 E192G probably damaging Het
Myo5b A T 18: 74,728,954 probably benign Het
Ncam2 G T 16: 81,200,884 probably benign Het
Nip7 T C 8: 107,057,317 L63P probably damaging Het
Nsd3 T C 8: 25,648,434 probably benign Het
Nup98 A T 7: 102,138,797 V1022D probably benign Het
Olfr1173 A G 2: 88,274,215 V278A possibly damaging Het
Olfr1391 T A 11: 49,327,917 C169S probably damaging Het
Olfr190 A G 16: 59,074,270 I270T probably benign Het
Olfr846 A T 9: 19,360,881 L158* probably null Het
P4ha2 T C 11: 54,117,608 Y214H possibly damaging Het
Pacrg A T 17: 10,576,478 F184L possibly damaging Het
Parpbp T A 10: 88,093,707 R426S probably damaging Het
Pcdhb5 T A 18: 37,321,306 Y246* probably null Het
Pik3cg T A 12: 32,194,771 T895S probably damaging Het
Prkch T C 12: 73,691,652 Y178H probably benign Het
Rusc2 G T 4: 43,425,486 R1197L probably damaging Het
Svep1 T C 4: 58,054,700 E3296G possibly damaging Het
Svs3a A G 2: 164,289,881 K123R probably benign Het
Sycp2l A G 13: 41,150,530 probably null Het
Syne3 T C 12: 104,943,426 H717R probably benign Het
Tiprl A G 1: 165,222,523 probably null Het
Trim24 T G 6: 37,915,195 V151G possibly damaging Het
Trim33 T C 3: 103,326,901 V56A possibly damaging Het
Trim67 C A 8: 124,794,658 T253K probably benign Het
Trip12 T C 1: 84,726,207 E698G probably damaging Het
Tspan14 T C 14: 40,915,396 D145G probably damaging Het
Ushbp1 G A 8: 71,394,377 Q204* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r75 G T 7: 86,165,513 N257K probably benign Het
Zc3h7b G A 15: 81,781,968 D560N probably damaging Het
Zscan21 T C 5: 138,125,140 V27A probably benign Het
Zzef1 A C 11: 72,923,111 E2842A probably damaging Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
R7144:Washc4 UTSW 10 83573774 critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83591033 missense probably damaging 0.99
R7477:Washc4 UTSW 10 83574443 missense probably damaging 0.99
R7900:Washc4 UTSW 10 83573773 splice site probably null
R8491:Washc4 UTSW 10 83576123 missense probably benign 0.24
R8791:Washc4 UTSW 10 83550884 missense probably benign 0.08
R8804:Washc4 UTSW 10 83572151 missense probably damaging 0.99
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAAACCCTCCTTTCCAGTGTGTCAG -3'
(R):5'- TGAAAGTGCAGTACAAAGAGCCCAC -3'

Sequencing Primer
(F):5'- TCACCTCACCAAGGTGTTGATAG -3'
(R):5'- ACAAATTCCAACATACTTGTCTCTC -3'
Posted On2013-06-11