Incidental Mutation 'R0471:Prkch'
ID46779
Institutional Source Beutler Lab
Gene Symbol Prkch
Ensembl Gene ENSMUSG00000021108
Gene Nameprotein kinase C, eta
SynonymsPkch
MMRRC Submission 038671-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0471 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location73584796-73778185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73691652 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 178 (Y178H)
Ref Sequence ENSEMBL: ENSMUSP00000021527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021527] [ENSMUST00000221153]
Predicted Effect probably benign
Transcript: ENSMUST00000021527
AA Change: Y178H

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108
AA Change: Y178H

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 614 5.62e-100 SMART
S_TK_X 615 678 8.32e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119092
SMART Domains Protein: ENSMUSP00000112499
Gene: ENSMUSG00000021108

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 597 6.67e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221153
Meta Mutation Damage Score 0.2070 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik G A 4: 35,193,257 T232I probably benign Het
Acp6 T C 3: 97,168,575 probably null Het
Adam33 C A 2: 131,054,479 G437C probably damaging Het
Aldh1a1 T A 19: 20,602,013 M1K probably null Het
Amotl2 C A 9: 102,720,519 P126Q probably damaging Het
Ap1g1 T A 8: 109,853,643 M576K possibly damaging Het
Apob C A 12: 7,990,406 A581E probably damaging Het
Asb7 A T 7: 66,679,159 D44E probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc65 A T 15: 98,717,467 H118L probably benign Het
Cdc25b A G 2: 131,197,284 E523G probably damaging Het
Cdk11b A G 4: 155,647,542 probably benign Het
Clec1b A G 6: 129,401,607 probably benign Het
Cntrl A G 2: 35,127,380 T400A probably benign Het
Cpne4 T G 9: 105,022,282 probably null Het
Cyp2j6 T A 4: 96,531,748 R249* probably null Het
Dock2 T C 11: 34,688,553 I678V probably benign Het
Dqx1 C T 6: 83,059,426 probably benign Het
Dsp A T 13: 38,193,350 K1704* probably null Het
Eif2b2 T C 12: 85,220,183 F121S probably benign Het
Ephx4 T C 5: 107,413,513 V69A possibly damaging Het
Epn2 T C 11: 61,535,308 Q281R probably damaging Het
Fgf3 A C 7: 144,842,810 D187A probably damaging Het
Galnt18 C A 7: 111,779,299 probably benign Het
Gm4871 C T 5: 145,031,592 probably benign Het
Ick G T 9: 78,155,517 probably null Het
Inpp4b T C 8: 82,041,899 I679T possibly damaging Het
Itpkb A G 1: 180,418,255 E779G probably damaging Het
Itsn1 G A 16: 91,899,589 V27M probably damaging Het
Lrp2 C A 2: 69,525,234 R422L probably damaging Het
Mmp25 G A 17: 23,639,884 A231V possibly damaging Het
Mprip T C 11: 59,759,735 S1422P probably damaging Het
Mro A T 18: 73,876,789 Q176L probably benign Het
Mrpl12 A G 11: 120,488,403 E192G probably damaging Het
Myo5b A T 18: 74,728,954 probably benign Het
Ncam2 G T 16: 81,200,884 probably benign Het
Nip7 T C 8: 107,057,317 L63P probably damaging Het
Nsd3 T C 8: 25,648,434 probably benign Het
Nup98 A T 7: 102,138,797 V1022D probably benign Het
Olfr1173 A G 2: 88,274,215 V278A possibly damaging Het
Olfr1391 T A 11: 49,327,917 C169S probably damaging Het
Olfr190 A G 16: 59,074,270 I270T probably benign Het
Olfr846 A T 9: 19,360,881 L158* probably null Het
P4ha2 T C 11: 54,117,608 Y214H possibly damaging Het
Pacrg A T 17: 10,576,478 F184L possibly damaging Het
Parpbp T A 10: 88,093,707 R426S probably damaging Het
Pcdhb5 T A 18: 37,321,306 Y246* probably null Het
Pik3cg T A 12: 32,194,771 T895S probably damaging Het
Rusc2 G T 4: 43,425,486 R1197L probably damaging Het
Svep1 T C 4: 58,054,700 E3296G possibly damaging Het
Svs3a A G 2: 164,289,881 K123R probably benign Het
Sycp2l A G 13: 41,150,530 probably null Het
Syne3 T C 12: 104,943,426 H717R probably benign Het
Tiprl A G 1: 165,222,523 probably null Het
Trim24 T G 6: 37,915,195 V151G possibly damaging Het
Trim33 T C 3: 103,326,901 V56A possibly damaging Het
Trim67 C A 8: 124,794,658 T253K probably benign Het
Trip12 T C 1: 84,726,207 E698G probably damaging Het
Tspan14 T C 14: 40,915,396 D145G probably damaging Het
Ushbp1 G A 8: 71,394,377 Q204* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r75 G T 7: 86,165,513 N257K probably benign Het
Washc4 T C 10: 83,558,734 probably benign Het
Zc3h7b G A 15: 81,781,968 D560N probably damaging Het
Zscan21 T C 5: 138,125,140 V27A probably benign Het
Zzef1 A C 11: 72,923,111 E2842A probably damaging Het
Other mutations in Prkch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Prkch APN 12 73702589 splice site probably benign
IGL00548:Prkch APN 12 73702811 missense probably damaging 1.00
IGL01310:Prkch APN 12 73759013 missense possibly damaging 0.78
IGL01782:Prkch APN 12 73759662 missense probably damaging 1.00
IGL02335:Prkch APN 12 73702512 missense probably benign 0.00
R0084:Prkch UTSW 12 73697987 missense possibly damaging 0.87
R0127:Prkch UTSW 12 73721787 missense possibly damaging 0.94
R0490:Prkch UTSW 12 73759676 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1552:Prkch UTSW 12 73702546 missense probably benign 0.33
R1572:Prkch UTSW 12 73649357 critical splice donor site probably null
R1651:Prkch UTSW 12 73759001 missense possibly damaging 0.88
R2114:Prkch UTSW 12 73702516 missense probably benign
R3714:Prkch UTSW 12 73775516 missense probably damaging 1.00
R4515:Prkch UTSW 12 73702838 missense possibly damaging 0.76
R4749:Prkch UTSW 12 73692960 missense probably damaging 1.00
R4977:Prkch UTSW 12 73702893 missense possibly damaging 0.52
R5381:Prkch UTSW 12 73691592 missense probably damaging 0.99
R5682:Prkch UTSW 12 73697950 missense probably damaging 1.00
R6526:Prkch UTSW 12 73702775 missense probably damaging 1.00
R6864:Prkch UTSW 12 73759617 missense probably damaging 1.00
R7484:Prkch UTSW 12 73585527 critical splice donor site probably null
R8074:Prkch UTSW 12 73700267 missense possibly damaging 0.49
R8294:Prkch UTSW 12 73759710 missense probably damaging 1.00
R8301:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R8312:Prkch UTSW 12 73760584 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCATCATTTGGGTTCTAAGGTTGGCAG -3'
(R):5'- ACTGATCACACGATCCATGCCTTC -3'

Sequencing Primer
(F):5'- ccctaaagttcctcctgtctc -3'
(R):5'- GCCTTCCTCAAAGCATTAATAACTTC -3'
Posted On2013-06-11