Mutagenetix > Incidental Mutation

Incidental Mutation 'R0471:Prkch'

46779

Institutional Source

Beutler Lab

Gene Symbol

Prkch

Ensembl Gene

ENSMUSG00000021108

Gene Name

protein kinase C, eta

Synonyms

Pkch

MMRRC Submission

038671-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0471 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73584796-73778185 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73691652 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 178 (Y178H)

Ref Sequence

ENSEMBL: ENSMUSP00000021527 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021527] [ENSMUST00000221153]

AlphaFold

P23298

Predicted Effect

probably benign
Transcript: ENSMUST00000021527
AA Change: Y178H

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108
AA Change: Y178H

Domain	Start	End	E-Value	Type
C2	11	117	1.28e-13	SMART
C1	172	222	7.92e-14	SMART
C1	246	295	2.48e-15	SMART
S_TKc	355	614	5.62e-100	SMART
S_TK_X	615	678	8.32e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119092

SMART Domains

Protein: ENSMUSP00000112499
Gene: ENSMUSG00000021108

Domain	Start	End	E-Value	Type
C2	11	117	1.28e-13	SMART
C1	172	222	7.92e-14	SMART
C1	246	295	2.48e-15	SMART
S_TKc	355	597	6.67e-84	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221153

Meta Mutation Damage Score

0.2070

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	G	A	4: 35,193,257	T232I	probably benign	Het
Acp6	T	C	3: 97,168,575		probably null	Het
Adam33	C	A	2: 131,054,479	G437C	probably damaging	Het
Aldh1a1	T	A	19: 20,602,013	M1K	probably null	Het
Amotl2	C	A	9: 102,720,519	P126Q	probably damaging	Het
Ap1g1	T	A	8: 109,853,643	M576K	possibly damaging	Het
Apob	C	A	12: 7,990,406	A581E	probably damaging	Het
Asb7	A	T	7: 66,679,159	D44E	probably damaging	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc65	A	T	15: 98,717,467	H118L	probably benign	Het
Cdc25b	A	G	2: 131,197,284	E523G	probably damaging	Het
Cdk11b	A	G	4: 155,647,542		probably benign	Het
Clec1b	A	G	6: 129,401,607		probably benign	Het
Cntrl	A	G	2: 35,127,380	T400A	probably benign	Het
Cpne4	T	G	9: 105,022,282		probably null	Het
Cyp2j6	T	A	4: 96,531,748	R249*	probably null	Het
Dock2	T	C	11: 34,688,553	I678V	probably benign	Het
Dqx1	C	T	6: 83,059,426		probably benign	Het
Dsp	A	T	13: 38,193,350	K1704*	probably null	Het
Eif2b2	T	C	12: 85,220,183	F121S	probably benign	Het
Ephx4	T	C	5: 107,413,513	V69A	possibly damaging	Het
Epn2	T	C	11: 61,535,308	Q281R	probably damaging	Het
Fgf3	A	C	7: 144,842,810	D187A	probably damaging	Het
Galnt18	C	A	7: 111,779,299		probably benign	Het
Gm4871	C	T	5: 145,031,592		probably benign	Het
Ick	G	T	9: 78,155,517		probably null	Het
Inpp4b	T	C	8: 82,041,899	I679T	possibly damaging	Het
Itpkb	A	G	1: 180,418,255	E779G	probably damaging	Het
Itsn1	G	A	16: 91,899,589	V27M	probably damaging	Het
Lrp2	C	A	2: 69,525,234	R422L	probably damaging	Het
Mmp25	G	A	17: 23,639,884	A231V	possibly damaging	Het
Mprip	T	C	11: 59,759,735	S1422P	probably damaging	Het
Mro	A	T	18: 73,876,789	Q176L	probably benign	Het
Mrpl12	A	G	11: 120,488,403	E192G	probably damaging	Het
Myo5b	A	T	18: 74,728,954		probably benign	Het
Ncam2	G	T	16: 81,200,884		probably benign	Het
Nip7	T	C	8: 107,057,317	L63P	probably damaging	Het
Nsd3	T	C	8: 25,648,434		probably benign	Het
Nup98	A	T	7: 102,138,797	V1022D	probably benign	Het
Olfr1173	A	G	2: 88,274,215	V278A	possibly damaging	Het
Olfr1391	T	A	11: 49,327,917	C169S	probably damaging	Het
Olfr190	A	G	16: 59,074,270	I270T	probably benign	Het
Olfr846	A	T	9: 19,360,881	L158*	probably null	Het
P4ha2	T	C	11: 54,117,608	Y214H	possibly damaging	Het
Pacrg	A	T	17: 10,576,478	F184L	possibly damaging	Het
Parpbp	T	A	10: 88,093,707	R426S	probably damaging	Het
Pcdhb5	T	A	18: 37,321,306	Y246*	probably null	Het
Pik3cg	T	A	12: 32,194,771	T895S	probably damaging	Het
Rusc2	G	T	4: 43,425,486	R1197L	probably damaging	Het
Svep1	T	C	4: 58,054,700	E3296G	possibly damaging	Het
Svs3a	A	G	2: 164,289,881	K123R	probably benign	Het
Sycp2l	A	G	13: 41,150,530		probably null	Het
Syne3	T	C	12: 104,943,426	H717R	probably benign	Het
Tiprl	A	G	1: 165,222,523		probably null	Het
Trim24	T	G	6: 37,915,195	V151G	possibly damaging	Het
Trim33	T	C	3: 103,326,901	V56A	possibly damaging	Het
Trim67	C	A	8: 124,794,658	T253K	probably benign	Het
Trip12	T	C	1: 84,726,207	E698G	probably damaging	Het
Tspan14	T	C	14: 40,915,396	D145G	probably damaging	Het
Ushbp1	G	A	8: 71,394,377	Q204*	probably null	Het
Vmn1r71	G	C	7: 10,748,092	S223C	possibly damaging	Het
Vmn2r75	G	T	7: 86,165,513	N257K	probably benign	Het
Washc4	T	C	10: 83,558,734		probably benign	Het
Zc3h7b	G	A	15: 81,781,968	D560N	probably damaging	Het
Zscan21	T	C	5: 138,125,140	V27A	probably benign	Het
Zzef1	A	C	11: 72,923,111	E2842A	probably damaging	Het

Other mutations in Prkch

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Prkch	APN	12	73702589	splice site	probably benign
IGL00548:Prkch	APN	12	73702811	missense	probably damaging	1.00
IGL01310:Prkch	APN	12	73759013	missense	possibly damaging	0.78
IGL01782:Prkch	APN	12	73759662	missense	probably damaging	1.00
IGL02335:Prkch	APN	12	73702512	missense	probably benign	0.00
Nighthawk	UTSW	12	73721842	missense	probably damaging	1.00
Topsoil	UTSW	12	73585527	critical splice donor site	probably null
wolfcreek	UTSW	12	73759710	missense	probably damaging	1.00
G1Funyon:Prkch	UTSW	12	73702764	missense	possibly damaging	0.71
R0084:Prkch	UTSW	12	73697987	missense	possibly damaging	0.87
R0127:Prkch	UTSW	12	73721787	missense	possibly damaging	0.94
R0490:Prkch	UTSW	12	73759676	missense	probably damaging	1.00
R1402:Prkch	UTSW	12	73585389	missense	probably damaging	1.00
R1402:Prkch	UTSW	12	73585389	missense	probably damaging	1.00
R1552:Prkch	UTSW	12	73702546	missense	probably benign	0.33
R1572:Prkch	UTSW	12	73649357	critical splice donor site	probably null
R1651:Prkch	UTSW	12	73759001	missense	possibly damaging	0.88
R2114:Prkch	UTSW	12	73702516	missense	probably benign
R3714:Prkch	UTSW	12	73775516	missense	probably damaging	1.00
R4515:Prkch	UTSW	12	73702838	missense	possibly damaging	0.76
R4749:Prkch	UTSW	12	73692960	missense	probably damaging	1.00
R4977:Prkch	UTSW	12	73702893	missense	possibly damaging	0.52
R5381:Prkch	UTSW	12	73691592	missense	probably damaging	0.99
R5682:Prkch	UTSW	12	73697950	missense	probably damaging	1.00
R6526:Prkch	UTSW	12	73702775	missense	probably damaging	1.00
R6864:Prkch	UTSW	12	73759617	missense	probably damaging	1.00
R7484:Prkch	UTSW	12	73585527	critical splice donor site	probably null
R8074:Prkch	UTSW	12	73700267	missense	possibly damaging	0.49
R8294:Prkch	UTSW	12	73759710	missense	probably damaging	1.00
R8301:Prkch	UTSW	12	73702764	missense	possibly damaging	0.71
R8312:Prkch	UTSW	12	73760584	missense	noncoding transcript
R8734:Prkch	UTSW	12	73585244	missense	possibly damaging	0.62
R8766:Prkch	UTSW	12	73702538	missense	probably benign	0.01
R8998:Prkch	UTSW	12	73696199	missense	probably damaging	1.00
R8999:Prkch	UTSW	12	73696199	missense	probably damaging	1.00
R9058:Prkch	UTSW	12	73775534	critical splice donor site	probably null
R9152:Prkch	UTSW	12	73691644	missense	possibly damaging	0.91
R9176:Prkch	UTSW	12	73700194	missense	probably damaging	1.00
R9194:Prkch	UTSW	12	73721842	missense	probably damaging	1.00
R9691:Prkch	UTSW	12	73758956	missense	probably damaging	1.00
R9764:Prkch	UTSW	12	73700304	missense	probably benign	0.00
R9794:Prkch	UTSW	12	73697970	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- CCATCATTTGGGTTCTAAGGTTGGCAG -3'
(R):5'- ACTGATCACACGATCCATGCCTTC -3'

Sequencing Primer
(F):5'- ccctaaagttcctcctgtctc -3'
(R):5'- GCCTTCCTCAAAGCATTAATAACTTC -3'

Posted On

2013-06-11