Incidental Mutation 'R0471:Eif2b2'
ID46780
Institutional Source Beutler Lab
Gene Symbol Eif2b2
Ensembl Gene ENSMUSG00000004788
Gene Nameeukaryotic translation initiation factor 2B, subunit 2 beta
SynonymsEIF2B, EIF-2Bbeta
MMRRC Submission 038671-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0471 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location85219481-85226628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85220183 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 121 (F121S)
Ref Sequence ENSEMBL: ENSMUSP00000122954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004910] [ENSMUST00000136495] [ENSMUST00000140900]
Predicted Effect probably benign
Transcript: ENSMUST00000004910
AA Change: F124S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004910
Gene: ENSMUSG00000004788
AA Change: F124S

DomainStartEndE-ValueType
Pfam:IF-2B 27 333 3.2e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130760
Predicted Effect probably benign
Transcript: ENSMUST00000136495
AA Change: F124S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122720
Gene: ENSMUSG00000004788
AA Change: F124S

DomainStartEndE-ValueType
Pfam:IF-2B 27 232 2e-51 PFAM
Pfam:IF-2B 229 287 4.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140900
AA Change: F121S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122954
Gene: ENSMUSG00000004788
AA Change: F121S

DomainStartEndE-ValueType
Pfam:IF-2B 27 228 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151925
Meta Mutation Damage Score 0.0723 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of eukaryotic initiation factor-2B (EIF2B). EIF2B is involved in protein synthesis and exchanges GDP and GTP for its activation and deactivation. Mutations in the human gene are associated with ovarioleukodystrophy and leukoencephalopathy with vanishing white matter. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik G A 4: 35,193,257 T232I probably benign Het
Acp6 T C 3: 97,168,575 probably null Het
Adam33 C A 2: 131,054,479 G437C probably damaging Het
Aldh1a1 T A 19: 20,602,013 M1K probably null Het
Amotl2 C A 9: 102,720,519 P126Q probably damaging Het
Ap1g1 T A 8: 109,853,643 M576K possibly damaging Het
Apob C A 12: 7,990,406 A581E probably damaging Het
Asb7 A T 7: 66,679,159 D44E probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc65 A T 15: 98,717,467 H118L probably benign Het
Cdc25b A G 2: 131,197,284 E523G probably damaging Het
Cdk11b A G 4: 155,647,542 probably benign Het
Clec1b A G 6: 129,401,607 probably benign Het
Cntrl A G 2: 35,127,380 T400A probably benign Het
Cpne4 T G 9: 105,022,282 probably null Het
Cyp2j6 T A 4: 96,531,748 R249* probably null Het
Dock2 T C 11: 34,688,553 I678V probably benign Het
Dqx1 C T 6: 83,059,426 probably benign Het
Dsp A T 13: 38,193,350 K1704* probably null Het
Ephx4 T C 5: 107,413,513 V69A possibly damaging Het
Epn2 T C 11: 61,535,308 Q281R probably damaging Het
Fgf3 A C 7: 144,842,810 D187A probably damaging Het
Galnt18 C A 7: 111,779,299 probably benign Het
Gm4871 C T 5: 145,031,592 probably benign Het
Ick G T 9: 78,155,517 probably null Het
Inpp4b T C 8: 82,041,899 I679T possibly damaging Het
Itpkb A G 1: 180,418,255 E779G probably damaging Het
Itsn1 G A 16: 91,899,589 V27M probably damaging Het
Lrp2 C A 2: 69,525,234 R422L probably damaging Het
Mmp25 G A 17: 23,639,884 A231V possibly damaging Het
Mprip T C 11: 59,759,735 S1422P probably damaging Het
Mro A T 18: 73,876,789 Q176L probably benign Het
Mrpl12 A G 11: 120,488,403 E192G probably damaging Het
Myo5b A T 18: 74,728,954 probably benign Het
Ncam2 G T 16: 81,200,884 probably benign Het
Nip7 T C 8: 107,057,317 L63P probably damaging Het
Nsd3 T C 8: 25,648,434 probably benign Het
Nup98 A T 7: 102,138,797 V1022D probably benign Het
Olfr1173 A G 2: 88,274,215 V278A possibly damaging Het
Olfr1391 T A 11: 49,327,917 C169S probably damaging Het
Olfr190 A G 16: 59,074,270 I270T probably benign Het
Olfr846 A T 9: 19,360,881 L158* probably null Het
P4ha2 T C 11: 54,117,608 Y214H possibly damaging Het
Pacrg A T 17: 10,576,478 F184L possibly damaging Het
Parpbp T A 10: 88,093,707 R426S probably damaging Het
Pcdhb5 T A 18: 37,321,306 Y246* probably null Het
Pik3cg T A 12: 32,194,771 T895S probably damaging Het
Prkch T C 12: 73,691,652 Y178H probably benign Het
Rusc2 G T 4: 43,425,486 R1197L probably damaging Het
Svep1 T C 4: 58,054,700 E3296G possibly damaging Het
Svs3a A G 2: 164,289,881 K123R probably benign Het
Sycp2l A G 13: 41,150,530 probably null Het
Syne3 T C 12: 104,943,426 H717R probably benign Het
Tiprl A G 1: 165,222,523 probably null Het
Trim24 T G 6: 37,915,195 V151G possibly damaging Het
Trim33 T C 3: 103,326,901 V56A possibly damaging Het
Trim67 C A 8: 124,794,658 T253K probably benign Het
Trip12 T C 1: 84,726,207 E698G probably damaging Het
Tspan14 T C 14: 40,915,396 D145G probably damaging Het
Ushbp1 G A 8: 71,394,377 Q204* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r75 G T 7: 86,165,513 N257K probably benign Het
Washc4 T C 10: 83,558,734 probably benign Het
Zc3h7b G A 15: 81,781,968 D560N probably damaging Het
Zscan21 T C 5: 138,125,140 V27A probably benign Het
Zzef1 A C 11: 72,923,111 E2842A probably damaging Het
Other mutations in Eif2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Eif2b2 APN 12 85219834 missense probably benign 0.00
IGL03156:Eif2b2 APN 12 85219721 missense probably damaging 1.00
IGL03238:Eif2b2 APN 12 85223399 missense probably benign 0.01
R0785:Eif2b2 UTSW 12 85221561 missense probably damaging 1.00
R1368:Eif2b2 UTSW 12 85223456 missense probably damaging 0.98
R1442:Eif2b2 UTSW 12 85219586 missense probably benign 0.00
R3162:Eif2b2 UTSW 12 85219661 missense probably benign
R3162:Eif2b2 UTSW 12 85219661 missense probably benign
R5931:Eif2b2 UTSW 12 85222787 missense probably damaging 1.00
R6954:Eif2b2 UTSW 12 85226043 missense probably damaging 0.98
Z1177:Eif2b2 UTSW 12 85219564 start codon destroyed probably null 0.97
Z1177:Eif2b2 UTSW 12 85223415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATGGCAGGTCAAACTCACAGC -3'
(R):5'- GGGTGTTCAAACCAGAAGACTGGTG -3'

Sequencing Primer
(F):5'- TCAAACTCACAGCTTGGGTG -3'
(R):5'- GAAGACTGGTGATCTCGCCTATC -3'
Posted On2013-06-11