Incidental Mutation 'R0472:Clvs1'
ID 46810
Institutional Source Beutler Lab
Gene Symbol Clvs1
Ensembl Gene ENSMUSG00000041216
Gene Name clavesin 1
Synonyms 4933402J24Rik, Rlbp1l1
MMRRC Submission 038672-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0472 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 9269293-9451691 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 9281801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 82 (A82T)
Ref Sequence ENSEMBL: ENSMUSP00000103985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038841] [ENSMUST00000108348]
AlphaFold Q9D4C9
Predicted Effect probably damaging
Transcript: ENSMUST00000038841
AA Change: A82T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035649
Gene: ENSMUSG00000041216
AA Change: A82T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108348
AA Change: A82T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103985
Gene: ENSMUSG00000041216
AA Change: A82T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149848
Meta Mutation Damage Score 0.6472 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,222,122 noncoding transcript Het
AI182371 T C 2: 35,085,206 N337S probably benign Het
Aldh3b1 C T 19: 3,914,024 R426H probably damaging Het
Arap2 A G 5: 62,706,659 F541L probably damaging Het
Asap2 G T 12: 21,213,185 R267L possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Bmp8b T A 4: 123,121,899 D226E probably benign Het
C1ra T A 6: 124,517,444 D283E possibly damaging Het
Cacul1 G T 19: 60,543,026 H268Q probably damaging Het
Cd9 T C 6: 125,472,433 N49D probably benign Het
Cdc42bpa A G 1: 180,040,179 H193R probably damaging Het
Cep290 G A 10: 100,551,455 G1935E probably benign Het
Cep350 A T 1: 155,914,723 I1362N probably damaging Het
Chchd7 A T 4: 3,943,416 N61I possibly damaging Het
Clca1 A T 3: 145,027,345 L134Q probably damaging Het
Clec2j T C 6: 128,656,602 noncoding transcript Het
Csn1s1 A T 5: 87,677,627 Y231F possibly damaging Het
Cyp2c55 A T 19: 39,031,379 T254S probably benign Het
D430042O09Rik A G 7: 125,872,967 N1548S probably damaging Het
Decr1 A G 4: 15,919,849 S290P probably damaging Het
Dnaic2 T A 11: 114,745,189 probably benign Het
Dock4 C A 12: 40,838,438 probably benign Het
Dst T C 1: 34,266,960 probably null Het
Elmo2 A G 2: 165,298,330 I315T probably damaging Het
Fam208b A G 13: 3,588,364 S456P possibly damaging Het
Fcho2 A G 13: 98,748,267 F431L probably benign Het
Fez2 A G 17: 78,384,832 probably benign Het
Gas2l3 C T 10: 89,426,477 A128T probably damaging Het
Hpse2 T C 19: 43,013,163 I222M probably damaging Het
Kcna2 A G 3: 107,105,516 D471G probably benign Het
Kcnj13 T A 1: 87,386,846 Y218F probably benign Het
Kif1a T C 1: 93,018,997 H1763R probably damaging Het
Krt2 C T 15: 101,813,253 R451H probably damaging Het
Lama2 A G 10: 26,990,867 V2877A probably damaging Het
Lrrc2 A T 9: 110,962,617 M80L probably benign Het
Naip6 A G 13: 100,302,260 V343A probably benign Het
Nedd4l T C 18: 65,208,461 Y753H probably damaging Het
Nif3l1 A C 1: 58,447,828 S58R probably damaging Het
Olfr1153 T A 2: 87,896,493 V98E possibly damaging Het
Olfr573-ps1 A T 7: 102,942,051 C175* probably null Het
Olfr823 G A 10: 130,112,580 S70F probably damaging Het
Osbpl11 C A 16: 33,234,444 Y632* probably null Het
Pask A T 1: 93,320,917 D920E probably benign Het
Pclo T C 5: 14,681,594 V3370A unknown Het
Ptpn21 G A 12: 98,704,240 probably benign Het
Rph3al T C 11: 75,908,969 I55V probably benign Het
Rsad2 T G 12: 26,454,168 I121L possibly damaging Het
Sergef T G 7: 46,633,746 probably benign Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Tas2r104 T C 6: 131,685,471 I92V probably benign Het
Tbc1d23 T A 16: 57,173,106 I566F possibly damaging Het
Tbc1d9b A G 11: 50,168,228 probably null Het
Tie1 T A 4: 118,476,147 I841L possibly damaging Het
Tpo A G 12: 30,100,486 V465A probably benign Het
Ttll3 A T 6: 113,409,339 Q711L probably damaging Het
Ttn C T 2: 76,953,041 R869H probably benign Het
Uggt2 A G 14: 119,095,336 V62A probably damaging Het
Usp34 T C 11: 23,384,509 probably benign Het
Vmn1r17 C A 6: 57,361,319 M20I probably benign Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r120 C T 17: 57,524,518 V424I probably benign Het
Vps13b T C 15: 35,417,633 probably null Het
Wdfy3 C A 5: 101,957,443 A173S probably benign Het
Wdr59 T C 8: 111,486,997 probably null Het
Ythdc2 A T 18: 44,864,357 M994L probably benign Het
Zfp808 T A 13: 62,172,306 F450I probably damaging Het
Other mutations in Clvs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Clvs1 APN 4 9281939 missense probably damaging 1.00
IGL01293:Clvs1 APN 4 9281559 start codon destroyed probably null
IGL01463:Clvs1 APN 4 9429818 missense probably benign 0.27
IGL03031:Clvs1 APN 4 9449385 splice site probably benign
R0496:Clvs1 UTSW 4 9424241 missense probably damaging 1.00
R0848:Clvs1 UTSW 4 9282003 missense possibly damaging 0.83
R1541:Clvs1 UTSW 4 9281814 missense probably benign 0.00
R1992:Clvs1 UTSW 4 9281899 missense probably benign 0.01
R2901:Clvs1 UTSW 4 9281972 missense probably damaging 0.96
R2902:Clvs1 UTSW 4 9281972 missense probably damaging 0.96
R4321:Clvs1 UTSW 4 9282029 intron probably benign
R4934:Clvs1 UTSW 4 9424216 missense possibly damaging 0.91
R4946:Clvs1 UTSW 4 9281831 nonsense probably null
R4970:Clvs1 UTSW 4 9350857 intron probably benign
R5187:Clvs1 UTSW 4 9281865 missense possibly damaging 0.53
R5327:Clvs1 UTSW 4 9424261 missense probably damaging 1.00
R5605:Clvs1 UTSW 4 9281751 missense probably damaging 0.98
R5940:Clvs1 UTSW 4 9449443 missense possibly damaging 0.96
R6818:Clvs1 UTSW 4 9282014 critical splice donor site probably null
R6857:Clvs1 UTSW 4 9449433 missense probably benign 0.00
R7692:Clvs1 UTSW 4 9350739 missense probably benign 0.23
R8247:Clvs1 UTSW 4 9281885 missense possibly damaging 0.77
R8791:Clvs1 UTSW 4 9429807 missense probably damaging 1.00
R9500:Clvs1 UTSW 4 9429834 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACACTTCCATGTGAATGGGACCAG -3'
(R):5'- GGCAGCAAACAGCAAGAGAATCTTC -3'

Sequencing Primer
(F):5'- GCCAAGATGACGCATTTGC -3'
(R):5'- CAAGAGAATCTTCCTGCCATAGTG -3'
Posted On 2013-06-11