Incidental Mutation 'R0472:Wdfy3'
ID 46817
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene Name WD repeat and FYVE domain containing 3
Synonyms 2610509D04Rik, Ggtb3, Bchs, D5Ertd66e, Bwf1, Alfy
MMRRC Submission 038672-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.942) question?
Stock # R0472 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 101980822-102217787 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 102105309 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 173 (A173S)
Ref Sequence ENSEMBL: ENSMUSP00000134244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000174698] [ENSMUST00000212024]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053177
AA Change: A173S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: A173S

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174598
AA Change: A173S

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: A173S

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174698
AA Change: A173S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000134541
Gene: ENSMUSG00000043940
AA Change: A173S

DomainStartEndE-ValueType
Blast:WD40 235 281 2e-21 BLAST
low complexity region 463 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196920
Predicted Effect probably benign
Transcript: ENSMUST00000212024
AA Change: A173S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.0669 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,222,123 (GRCm39) noncoding transcript Het
AI182371 T C 2: 34,975,218 (GRCm39) N337S probably benign Het
Aldh3b1 C T 19: 3,964,024 (GRCm39) R426H probably damaging Het
Arap2 A G 5: 62,864,002 (GRCm39) F541L probably damaging Het
Asap2 G T 12: 21,263,186 (GRCm39) R267L possibly damaging Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Bmp8b T A 4: 123,015,692 (GRCm39) D226E probably benign Het
C1ra T A 6: 124,494,403 (GRCm39) D283E possibly damaging Het
Cacul1 G T 19: 60,531,464 (GRCm39) H268Q probably damaging Het
Cd9 T C 6: 125,449,396 (GRCm39) N49D probably benign Het
Cdc42bpa A G 1: 179,867,744 (GRCm39) H193R probably damaging Het
Cep290 G A 10: 100,387,317 (GRCm39) G1935E probably benign Het
Cep350 A T 1: 155,790,469 (GRCm39) I1362N probably damaging Het
Chchd7 A T 4: 3,943,416 (GRCm39) N61I possibly damaging Het
Clca3a1 A T 3: 144,733,106 (GRCm39) L134Q probably damaging Het
Clec2j T C 6: 128,633,565 (GRCm39) noncoding transcript Het
Clvs1 G A 4: 9,281,801 (GRCm39) A82T probably damaging Het
Csn1s1 A T 5: 87,825,486 (GRCm39) Y231F possibly damaging Het
Cyp2c55 A T 19: 39,019,823 (GRCm39) T254S probably benign Het
Decr1 A G 4: 15,919,849 (GRCm39) S290P probably damaging Het
Dnai2 T A 11: 114,636,015 (GRCm39) probably benign Het
Dock4 C A 12: 40,888,437 (GRCm39) probably benign Het
Dst T C 1: 34,306,041 (GRCm39) probably null Het
Elmo2 A G 2: 165,140,250 (GRCm39) I315T probably damaging Het
Fcho2 A G 13: 98,884,775 (GRCm39) F431L probably benign Het
Fez2 A G 17: 78,692,261 (GRCm39) probably benign Het
Gas2l3 C T 10: 89,262,339 (GRCm39) A128T probably damaging Het
Hpse2 T C 19: 43,001,602 (GRCm39) I222M probably damaging Het
Katnip A G 7: 125,472,139 (GRCm39) N1548S probably damaging Het
Kcna2 A G 3: 107,012,832 (GRCm39) D471G probably benign Het
Kcnj13 T A 1: 87,314,568 (GRCm39) Y218F probably benign Het
Kif1a T C 1: 92,946,719 (GRCm39) H1763R probably damaging Het
Krt1c C T 15: 101,721,688 (GRCm39) R451H probably damaging Het
Lama2 A G 10: 26,866,863 (GRCm39) V2877A probably damaging Het
Lrrc2 A T 9: 110,791,685 (GRCm39) M80L probably benign Het
Naip6 A G 13: 100,438,768 (GRCm39) V343A probably benign Het
Nedd4l T C 18: 65,341,532 (GRCm39) Y753H probably damaging Het
Nif3l1 A C 1: 58,486,987 (GRCm39) S58R probably damaging Het
Or51h7 A T 7: 102,591,258 (GRCm39) C175* probably null Het
Or5w20 T A 2: 87,726,837 (GRCm39) V98E possibly damaging Het
Or9r3 G A 10: 129,948,449 (GRCm39) S70F probably damaging Het
Osbpl11 C A 16: 33,054,814 (GRCm39) Y632* probably null Het
Pask A T 1: 93,248,639 (GRCm39) D920E probably benign Het
Pclo T C 5: 14,731,608 (GRCm39) V3370A unknown Het
Ptpn21 G A 12: 98,670,499 (GRCm39) probably benign Het
Rph3al T C 11: 75,799,795 (GRCm39) I55V probably benign Het
Rsad2 T G 12: 26,504,167 (GRCm39) I121L possibly damaging Het
Sergef T G 7: 46,283,170 (GRCm39) probably benign Het
Sp110 C T 1: 85,516,841 (GRCm39) E219K possibly damaging Het
Tas2r104 T C 6: 131,662,434 (GRCm39) I92V probably benign Het
Tasor2 A G 13: 3,638,364 (GRCm39) S456P possibly damaging Het
Tbc1d23 T A 16: 56,993,469 (GRCm39) I566F possibly damaging Het
Tbc1d9b A G 11: 50,059,055 (GRCm39) probably null Het
Tie1 T A 4: 118,333,344 (GRCm39) I841L possibly damaging Het
Tpo A G 12: 30,150,485 (GRCm39) V465A probably benign Het
Ttll3 A T 6: 113,386,300 (GRCm39) Q711L probably damaging Het
Ttn C T 2: 76,783,385 (GRCm39) R869H probably benign Het
Uggt2 A G 14: 119,332,748 (GRCm39) V62A probably damaging Het
Usp34 T C 11: 23,334,509 (GRCm39) probably benign Het
Vmn1r17 C A 6: 57,338,304 (GRCm39) M20I probably benign Het
Vmn1r71 G C 7: 10,482,019 (GRCm39) S223C possibly damaging Het
Vmn2r120 C T 17: 57,831,518 (GRCm39) V424I probably benign Het
Vps13b T C 15: 35,417,779 (GRCm39) probably null Het
Wdr59 T C 8: 112,213,629 (GRCm39) probably null Het
Ythdc2 A T 18: 44,997,424 (GRCm39) M994L probably benign Het
Zfp808 T A 13: 62,320,120 (GRCm39) F450I probably damaging Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 102,063,204 (GRCm39) critical splice donor site probably null
IGL00567:Wdfy3 APN 5 102,059,896 (GRCm39) splice site probably benign
IGL01288:Wdfy3 APN 5 102,049,857 (GRCm39) splice site probably null
IGL01323:Wdfy3 APN 5 102,042,930 (GRCm39) missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 102,091,986 (GRCm39) missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 102,047,897 (GRCm39) missense probably benign
IGL01560:Wdfy3 APN 5 102,105,352 (GRCm39) nonsense probably null
IGL01566:Wdfy3 APN 5 102,044,454 (GRCm39) splice site probably benign
IGL01616:Wdfy3 APN 5 102,061,126 (GRCm39) missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 102,055,354 (GRCm39) missense probably benign
IGL01791:Wdfy3 APN 5 102,085,278 (GRCm39) missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 102,071,947 (GRCm39) missense probably benign 0.11
IGL01953:Wdfy3 APN 5 102,042,894 (GRCm39) nonsense probably null
IGL02121:Wdfy3 APN 5 102,046,376 (GRCm39) missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 102,109,023 (GRCm39) missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 102,070,475 (GRCm39) missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 102,036,058 (GRCm39) missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 102,044,341 (GRCm39) missense probably benign 0.37
IGL02801:Wdfy3 APN 5 102,055,453 (GRCm39) missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 102,116,786 (GRCm39) missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 102,003,337 (GRCm39) missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 102,042,778 (GRCm39) missense probably null 1.00
IGL03064:Wdfy3 APN 5 102,083,863 (GRCm39) missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 102,014,142 (GRCm39) missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101,992,778 (GRCm39) splice site probably benign
IGL03237:Wdfy3 APN 5 101,992,465 (GRCm39) missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 102,048,016 (GRCm39) missense probably damaging 1.00
Esurient UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 102,077,847 (GRCm39) missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 102,030,827 (GRCm39) frame shift probably null
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101,992,912 (GRCm39) missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 102,037,161 (GRCm39) missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101,992,480 (GRCm39) missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 102,035,971 (GRCm39) missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0148:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0279:Wdfy3 UTSW 5 102,015,958 (GRCm39) missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 102,096,832 (GRCm39) missense probably damaging 0.99
R0513:Wdfy3 UTSW 5 102,038,655 (GRCm39) missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 102,054,051 (GRCm39) missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101,984,038 (GRCm39) missense probably benign
R0787:Wdfy3 UTSW 5 102,105,254 (GRCm39) missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 102,017,917 (GRCm39) missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 102,030,832 (GRCm39) missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 102,023,797 (GRCm39) missense probably benign
R1350:Wdfy3 UTSW 5 102,046,418 (GRCm39) missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 102,032,080 (GRCm39) splice site probably benign
R1446:Wdfy3 UTSW 5 101,999,176 (GRCm39) missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 102,085,604 (GRCm39) missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 102,065,445 (GRCm39) missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101,991,947 (GRCm39) missense probably benign
R1633:Wdfy3 UTSW 5 102,129,414 (GRCm39) missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 102,023,781 (GRCm39) missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 102,089,313 (GRCm39) missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 102,074,391 (GRCm39) frame shift probably null
R1743:Wdfy3 UTSW 5 101,991,931 (GRCm39) missense probably benign 0.12
R1745:Wdfy3 UTSW 5 102,096,795 (GRCm39) missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 102,042,865 (GRCm39) missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 102,063,242 (GRCm39) missense probably benign 0.00
R1854:Wdfy3 UTSW 5 102,036,052 (GRCm39) missense probably benign 0.05
R1880:Wdfy3 UTSW 5 102,065,301 (GRCm39) missense probably benign 0.05
R1930:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 102,067,275 (GRCm39) missense probably benign 0.30
R1965:Wdfy3 UTSW 5 102,099,178 (GRCm39) missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 102,008,352 (GRCm39) missense probably null 1.00
R2087:Wdfy3 UTSW 5 102,042,926 (GRCm39) missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 102,046,291 (GRCm39) critical splice donor site probably null
R2192:Wdfy3 UTSW 5 102,055,408 (GRCm39) missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 102,037,150 (GRCm39) missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 102,036,189 (GRCm39) splice site probably benign
R2406:Wdfy3 UTSW 5 102,036,125 (GRCm39) missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 102,023,796 (GRCm39) missense probably benign 0.04
R2937:Wdfy3 UTSW 5 102,091,988 (GRCm39) missense probably benign 0.07
R3765:Wdfy3 UTSW 5 102,009,266 (GRCm39) missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 102,085,466 (GRCm39) missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 102,092,105 (GRCm39) nonsense probably null
R3947:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 102,071,961 (GRCm39) splice site probably benign
R4065:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4066:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4110:Wdfy3 UTSW 5 102,047,924 (GRCm39) critical splice donor site probably null
R4235:Wdfy3 UTSW 5 102,070,500 (GRCm39) critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 102,058,850 (GRCm39) missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 102,054,011 (GRCm39) missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 102,031,949 (GRCm39) missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 102,091,800 (GRCm39) missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 102,077,894 (GRCm39) missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 102,091,809 (GRCm39) missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 102,042,787 (GRCm39) missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 102,096,838 (GRCm39) nonsense probably null
R4973:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4976:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4984:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4986:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R5068:Wdfy3 UTSW 5 102,042,803 (GRCm39) missense probably benign 0.15
R5105:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 102,015,972 (GRCm39) missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101,997,133 (GRCm39) critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101,994,972 (GRCm39) missense probably null 0.03
R5303:Wdfy3 UTSW 5 102,100,849 (GRCm39) missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 102,020,724 (GRCm39) missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 102,067,312 (GRCm39) missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 102,044,425 (GRCm39) missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101,984,140 (GRCm39) missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 102,009,314 (GRCm39) missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 102,017,855 (GRCm39) missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 102,032,004 (GRCm39) missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101,999,225 (GRCm39) missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101,997,289 (GRCm39) missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 102,046,295 (GRCm39) missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 102,061,045 (GRCm39) missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 102,101,032 (GRCm39) missense probably benign 0.19
R6776:Wdfy3 UTSW 5 102,031,911 (GRCm39) missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 102,065,297 (GRCm39) nonsense probably null
R6809:Wdfy3 UTSW 5 102,071,813 (GRCm39) missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 102,100,865 (GRCm39) missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101,991,932 (GRCm39) missense probably benign 0.10
R7014:Wdfy3 UTSW 5 102,042,775 (GRCm39) critical splice donor site probably null
R7034:Wdfy3 UTSW 5 102,055,384 (GRCm39) missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 102,063,303 (GRCm39) missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 102,091,758 (GRCm39) missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 102,049,785 (GRCm39) missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101,984,074 (GRCm39) missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 102,003,389 (GRCm39) missense probably benign 0.02
R7418:Wdfy3 UTSW 5 102,105,366 (GRCm39) missense probably benign 0.08
R7533:Wdfy3 UTSW 5 102,030,354 (GRCm39) missense probably benign 0.27
R7543:Wdfy3 UTSW 5 102,083,925 (GRCm39) missense probably benign 0.00
R7625:Wdfy3 UTSW 5 102,003,252 (GRCm39) splice site probably null
R7788:Wdfy3 UTSW 5 101,996,223 (GRCm39) missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 102,099,265 (GRCm39) nonsense probably null
R7810:Wdfy3 UTSW 5 102,042,940 (GRCm39) missense probably benign 0.01
R8204:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.00
R8268:Wdfy3 UTSW 5 102,089,476 (GRCm39) missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 102,085,287 (GRCm39) missense probably benign
R8507:Wdfy3 UTSW 5 102,020,767 (GRCm39) missense probably benign 0.05
R8514:Wdfy3 UTSW 5 101,999,219 (GRCm39) missense possibly damaging 0.92
R8536:Wdfy3 UTSW 5 102,033,064 (GRCm39) missense probably benign
R8710:Wdfy3 UTSW 5 102,030,349 (GRCm39) missense probably damaging 1.00
R8735:Wdfy3 UTSW 5 102,077,951 (GRCm39) missense probably benign 0.00
R8749:Wdfy3 UTSW 5 102,030,446 (GRCm39) missense probably damaging 1.00
R8931:Wdfy3 UTSW 5 102,065,421 (GRCm39) missense probably benign 0.11
R8943:Wdfy3 UTSW 5 101,993,231 (GRCm39) intron probably benign
R8968:Wdfy3 UTSW 5 102,011,983 (GRCm39) missense probably benign 0.05
R8979:Wdfy3 UTSW 5 102,096,764 (GRCm39) missense probably damaging 1.00
R8998:Wdfy3 UTSW 5 101,993,058 (GRCm39) missense probably benign 0.05
R9045:Wdfy3 UTSW 5 101,995,040 (GRCm39) missense probably damaging 1.00
R9068:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.34
R9105:Wdfy3 UTSW 5 102,030,512 (GRCm39) missense probably benign 0.05
R9122:Wdfy3 UTSW 5 102,091,831 (GRCm39) missense probably damaging 1.00
R9209:Wdfy3 UTSW 5 102,078,830 (GRCm39) missense probably benign 0.01
R9249:Wdfy3 UTSW 5 101,996,359 (GRCm39) missense possibly damaging 0.82
R9348:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R9481:Wdfy3 UTSW 5 102,000,478 (GRCm39) missense probably benign 0.19
R9490:Wdfy3 UTSW 5 102,078,716 (GRCm39) missense probably benign 0.29
R9524:Wdfy3 UTSW 5 102,055,333 (GRCm39) missense probably benign 0.03
R9545:Wdfy3 UTSW 5 102,100,957 (GRCm39) missense
R9548:Wdfy3 UTSW 5 102,033,059 (GRCm39) missense probably damaging 0.99
R9636:Wdfy3 UTSW 5 102,047,899 (GRCm39) missense probably benign
R9750:Wdfy3 UTSW 5 102,077,960 (GRCm39) missense probably benign 0.00
R9766:Wdfy3 UTSW 5 102,042,866 (GRCm39) missense possibly damaging 0.90
R9771:Wdfy3 UTSW 5 102,000,195 (GRCm39) missense probably damaging 1.00
Z1177:Wdfy3 UTSW 5 102,048,107 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CACAGACCTTCTTGTCACTATAAGGCG -3'
(R):5'- TTGAGTTCCCTGCTGCACAGAC -3'

Sequencing Primer
(F):5'- agcctatgcagtgagaacc -3'
(R):5'- AGTGCCGCTGGTAGATCATC -3'
Posted On 2013-06-11