Incidental Mutation 'R0472:Olfr573-ps1'
ID46826
Institutional Source Beutler Lab
Gene Symbol Olfr573-ps1
Ensembl Gene ENSMUSG00000052785
Gene Nameolfactory receptor 573, pseudogene 1
SynonymsMOR10-3P, MOR10-4, GA_x6K02T2PBJ9-5653743-5652872
MMRRC Submission 038672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0472 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102941682-102942575 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 102942051 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 175 (C175*)
Ref Sequence ENSEMBL: ENSMUSP00000147664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064830] [ENSMUST00000210571]
Predicted Effect probably null
Transcript: ENSMUST00000064830
AA Change: C175*
SMART Domains Protein: ENSMUSP00000065147
Gene: ENSMUSG00000052785
AA Change: C175*

DomainStartEndE-ValueType
Pfam:7tm_4 33 296 9.3e-109 PFAM
Pfam:7tm_1 43 288 4.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000064830
AA Change: C175*
Predicted Effect probably null
Transcript: ENSMUST00000210571
AA Change: C175*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,222,122 noncoding transcript Het
AI182371 T C 2: 35,085,206 N337S probably benign Het
Aldh3b1 C T 19: 3,914,024 R426H probably damaging Het
Arap2 A G 5: 62,706,659 F541L probably damaging Het
Asap2 G T 12: 21,213,185 R267L possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Bmp8b T A 4: 123,121,899 D226E probably benign Het
C1ra T A 6: 124,517,444 D283E possibly damaging Het
Cacul1 G T 19: 60,543,026 H268Q probably damaging Het
Cd9 T C 6: 125,472,433 N49D probably benign Het
Cdc42bpa A G 1: 180,040,179 H193R probably damaging Het
Cep290 G A 10: 100,551,455 G1935E probably benign Het
Cep350 A T 1: 155,914,723 I1362N probably damaging Het
Chchd7 A T 4: 3,943,416 N61I possibly damaging Het
Clca1 A T 3: 145,027,345 L134Q probably damaging Het
Clec2j T C 6: 128,656,602 noncoding transcript Het
Clvs1 G A 4: 9,281,801 A82T probably damaging Het
Csn1s1 A T 5: 87,677,627 Y231F possibly damaging Het
Cyp2c55 A T 19: 39,031,379 T254S probably benign Het
D430042O09Rik A G 7: 125,872,967 N1548S probably damaging Het
Decr1 A G 4: 15,919,849 S290P probably damaging Het
Dnaic2 T A 11: 114,745,189 probably benign Het
Dock4 C A 12: 40,838,438 probably benign Het
Dst T C 1: 34,266,960 probably null Het
Elmo2 A G 2: 165,298,330 I315T probably damaging Het
Fam208b A G 13: 3,588,364 S456P possibly damaging Het
Fcho2 A G 13: 98,748,267 F431L probably benign Het
Fez2 A G 17: 78,384,832 probably benign Het
Gas2l3 C T 10: 89,426,477 A128T probably damaging Het
Hpse2 T C 19: 43,013,163 I222M probably damaging Het
Kcna2 A G 3: 107,105,516 D471G probably benign Het
Kcnj13 T A 1: 87,386,846 Y218F probably benign Het
Kif1a T C 1: 93,018,997 H1763R probably damaging Het
Krt2 C T 15: 101,813,253 R451H probably damaging Het
Lama2 A G 10: 26,990,867 V2877A probably damaging Het
Lrrc2 A T 9: 110,962,617 M80L probably benign Het
Naip6 A G 13: 100,302,260 V343A probably benign Het
Nedd4l T C 18: 65,208,461 Y753H probably damaging Het
Nif3l1 A C 1: 58,447,828 S58R probably damaging Het
Olfr1153 T A 2: 87,896,493 V98E possibly damaging Het
Olfr823 G A 10: 130,112,580 S70F probably damaging Het
Osbpl11 C A 16: 33,234,444 Y632* probably null Het
Pask A T 1: 93,320,917 D920E probably benign Het
Pclo T C 5: 14,681,594 V3370A unknown Het
Ptpn21 G A 12: 98,704,240 probably benign Het
Rph3al T C 11: 75,908,969 I55V probably benign Het
Rsad2 T G 12: 26,454,168 I121L possibly damaging Het
Sergef T G 7: 46,633,746 probably benign Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Tas2r104 T C 6: 131,685,471 I92V probably benign Het
Tbc1d23 T A 16: 57,173,106 I566F possibly damaging Het
Tbc1d9b A G 11: 50,168,228 probably null Het
Tie1 T A 4: 118,476,147 I841L possibly damaging Het
Tpo A G 12: 30,100,486 V465A probably benign Het
Ttll3 A T 6: 113,409,339 Q711L probably damaging Het
Ttn C T 2: 76,953,041 R869H probably benign Het
Uggt2 A G 14: 119,095,336 V62A probably damaging Het
Usp34 T C 11: 23,384,509 probably benign Het
Vmn1r17 C A 6: 57,361,319 M20I probably benign Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r120 C T 17: 57,524,518 V424I probably benign Het
Vps13b T C 15: 35,417,633 probably null Het
Wdfy3 C A 5: 101,957,443 A173S probably benign Het
Wdr59 T C 8: 111,486,997 probably null Het
Ythdc2 A T 18: 44,864,357 M994L probably benign Het
Zfp808 T A 13: 62,172,306 F450I probably damaging Het
Other mutations in Olfr573-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1537:Olfr573-ps1 UTSW 7 102942340 missense probably damaging 1.00
R2168:Olfr573-ps1 UTSW 7 102942471 missense probably benign 0.00
R3781:Olfr573-ps1 UTSW 7 102942071 missense probably benign
R4198:Olfr573-ps1 UTSW 7 102941797 missense probably damaging 1.00
R4200:Olfr573-ps1 UTSW 7 102941797 missense probably damaging 1.00
R4333:Olfr573-ps1 UTSW 7 102941969 missense possibly damaging 0.50
R4838:Olfr573-ps1 UTSW 7 102942246 missense probably damaging 1.00
R5041:Olfr573-ps1 UTSW 7 102942578 unclassified probably null
R5371:Olfr573-ps1 UTSW 7 102942512 missense probably benign
R5668:Olfr573-ps1 UTSW 7 102941921 missense probably benign 0.44
R7836:Olfr573-ps1 UTSW 7 102941918 missense possibly damaging 0.94
R7887:Olfr573-ps1 UTSW 7 102942151 missense possibly damaging 0.94
R7991:Olfr573-ps1 UTSW 7 102942553 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AAATGCCCAGCACTGTCTTCAGG -3'
(R):5'- TGTGTGGCACAGATGTTCTTCATCC -3'

Sequencing Primer
(F):5'- CAGCACTGTCTTCAGGATGAG -3'
(R):5'- CTGGAGTCTTATTATCCATTATTGCC -3'
Posted On2013-06-11