Mutagenetix > Incidental Mutation

Incidental Mutation 'R0472:Usp34'

46834

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

038672-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.702) question?

Stock #

R0472 (G1)

Quality Score

208

Status

Validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 23384509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000137430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000137823

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000180046

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

97% (65/67)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700128F08Rik	A	G	9: 8,222,122		noncoding transcript	Het
AI182371	T	C	2: 35,085,206	N337S	probably benign	Het
Aldh3b1	C	T	19: 3,914,024	R426H	probably damaging	Het
Arap2	A	G	5: 62,706,659	F541L	probably damaging	Het
Asap2	G	T	12: 21,213,185	R267L	possibly damaging	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Bmp8b	T	A	4: 123,121,899	D226E	probably benign	Het
C1ra	T	A	6: 124,517,444	D283E	possibly damaging	Het
Cacul1	G	T	19: 60,543,026	H268Q	probably damaging	Het
Cd9	T	C	6: 125,472,433	N49D	probably benign	Het
Cdc42bpa	A	G	1: 180,040,179	H193R	probably damaging	Het
Cep290	G	A	10: 100,551,455	G1935E	probably benign	Het
Cep350	A	T	1: 155,914,723	I1362N	probably damaging	Het
Chchd7	A	T	4: 3,943,416	N61I	possibly damaging	Het
Clca1	A	T	3: 145,027,345	L134Q	probably damaging	Het
Clec2j	T	C	6: 128,656,602		noncoding transcript	Het
Clvs1	G	A	4: 9,281,801	A82T	probably damaging	Het
Csn1s1	A	T	5: 87,677,627	Y231F	possibly damaging	Het
Cyp2c55	A	T	19: 39,031,379	T254S	probably benign	Het
D430042O09Rik	A	G	7: 125,872,967	N1548S	probably damaging	Het
Decr1	A	G	4: 15,919,849	S290P	probably damaging	Het
Dnaic2	T	A	11: 114,745,189		probably benign	Het
Dock4	C	A	12: 40,838,438		probably benign	Het
Dst	T	C	1: 34,266,960		probably null	Het
Elmo2	A	G	2: 165,298,330	I315T	probably damaging	Het
Fam208b	A	G	13: 3,588,364	S456P	possibly damaging	Het
Fcho2	A	G	13: 98,748,267	F431L	probably benign	Het
Fez2	A	G	17: 78,384,832		probably benign	Het
Gas2l3	C	T	10: 89,426,477	A128T	probably damaging	Het
Hpse2	T	C	19: 43,013,163	I222M	probably damaging	Het
Kcna2	A	G	3: 107,105,516	D471G	probably benign	Het
Kcnj13	T	A	1: 87,386,846	Y218F	probably benign	Het
Kif1a	T	C	1: 93,018,997	H1763R	probably damaging	Het
Krt2	C	T	15: 101,813,253	R451H	probably damaging	Het
Lama2	A	G	10: 26,990,867	V2877A	probably damaging	Het
Lrrc2	A	T	9: 110,962,617	M80L	probably benign	Het
Naip6	A	G	13: 100,302,260	V343A	probably benign	Het
Nedd4l	T	C	18: 65,208,461	Y753H	probably damaging	Het
Nif3l1	A	C	1: 58,447,828	S58R	probably damaging	Het
Olfr1153	T	A	2: 87,896,493	V98E	possibly damaging	Het
Olfr573-ps1	A	T	7: 102,942,051	C175*	probably null	Het
Olfr823	G	A	10: 130,112,580	S70F	probably damaging	Het
Osbpl11	C	A	16: 33,234,444	Y632*	probably null	Het
Pask	A	T	1: 93,320,917	D920E	probably benign	Het
Pclo	T	C	5: 14,681,594	V3370A	unknown	Het
Ptpn21	G	A	12: 98,704,240		probably benign	Het
Rph3al	T	C	11: 75,908,969	I55V	probably benign	Het
Rsad2	T	G	12: 26,454,168	I121L	possibly damaging	Het
Sergef	T	G	7: 46,633,746		probably benign	Het
Sp110	C	T	1: 85,589,120	E219K	possibly damaging	Het
Tas2r104	T	C	6: 131,685,471	I92V	probably benign	Het
Tbc1d23	T	A	16: 57,173,106	I566F	possibly damaging	Het
Tbc1d9b	A	G	11: 50,168,228		probably null	Het
Tie1	T	A	4: 118,476,147	I841L	possibly damaging	Het
Tpo	A	G	12: 30,100,486	V465A	probably benign	Het
Ttll3	A	T	6: 113,409,339	Q711L	probably damaging	Het
Ttn	C	T	2: 76,953,041	R869H	probably benign	Het
Uggt2	A	G	14: 119,095,336	V62A	probably damaging	Het
Vmn1r17	C	A	6: 57,361,319	M20I	probably benign	Het
Vmn1r71	G	C	7: 10,748,092	S223C	possibly damaging	Het
Vmn2r120	C	T	17: 57,524,518	V424I	probably benign	Het
Vps13b	T	C	15: 35,417,633		probably null	Het
Wdfy3	C	A	5: 101,957,443	A173S	probably benign	Het
Wdr59	T	C	8: 111,486,997		probably null	Het
Ythdc2	A	T	18: 44,864,357	M994L	probably benign	Het
Zfp808	T	A	13: 62,172,306	F450I	probably damaging	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7836:Usp34	UTSW	11	23446614	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCGTTAGCCTTTAGCCGAAACATT -3'
(R):5'- GAAGCTATCATGAGACTTTCCATGCACT -3'

Sequencing Primer
(F):5'- ACCTCTGATGAAAATCATTGAAGC -3'
(R):5'- gcctgttagtccagcactc -3'

Posted On

2013-06-11