Incidental Mutation 'R0472:Dock4'
ID 46841
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms EST N28122, 6330411N01Rik
MMRRC Submission 038672-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.176) question?
Stock # R0472 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 40445952-40846874 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) C to A at 40838438 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably benign
Transcript: ENSMUST00000037488
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220912
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,222,122 (GRCm38) noncoding transcript Het
AI182371 T C 2: 35,085,206 (GRCm38) N337S probably benign Het
Aldh3b1 C T 19: 3,914,024 (GRCm38) R426H probably damaging Het
Arap2 A G 5: 62,706,659 (GRCm38) F541L probably damaging Het
Asap2 G T 12: 21,213,185 (GRCm38) R267L possibly damaging Het
Ass1 A T 2: 31,514,819 (GRCm38) N371Y probably damaging Het
Bmp8b T A 4: 123,121,899 (GRCm38) D226E probably benign Het
C1ra T A 6: 124,517,444 (GRCm38) D283E possibly damaging Het
Cacul1 G T 19: 60,543,026 (GRCm38) H268Q probably damaging Het
Cd9 T C 6: 125,472,433 (GRCm38) N49D probably benign Het
Cdc42bpa A G 1: 180,040,179 (GRCm38) H193R probably damaging Het
Cep290 G A 10: 100,551,455 (GRCm38) G1935E probably benign Het
Cep350 A T 1: 155,914,723 (GRCm38) I1362N probably damaging Het
Chchd7 A T 4: 3,943,416 (GRCm38) N61I possibly damaging Het
Clca1 A T 3: 145,027,345 (GRCm38) L134Q probably damaging Het
Clec2j T C 6: 128,656,602 (GRCm38) noncoding transcript Het
Clvs1 G A 4: 9,281,801 (GRCm38) A82T probably damaging Het
Csn1s1 A T 5: 87,677,627 (GRCm38) Y231F possibly damaging Het
Cyp2c55 A T 19: 39,031,379 (GRCm38) T254S probably benign Het
Decr1 A G 4: 15,919,849 (GRCm38) S290P probably damaging Het
Dnai2 T A 11: 114,745,189 (GRCm38) probably benign Het
Dst T C 1: 34,266,960 (GRCm38) probably null Het
Elmo2 A G 2: 165,298,330 (GRCm38) I315T probably damaging Het
Fcho2 A G 13: 98,748,267 (GRCm38) F431L probably benign Het
Fez2 A G 17: 78,384,832 (GRCm38) probably benign Het
Gas2l3 C T 10: 89,426,477 (GRCm38) A128T probably damaging Het
Hpse2 T C 19: 43,013,163 (GRCm38) I222M probably damaging Het
Katnip A G 7: 125,872,967 (GRCm38) N1548S probably damaging Het
Kcna2 A G 3: 107,105,516 (GRCm38) D471G probably benign Het
Kcnj13 T A 1: 87,386,846 (GRCm38) Y218F probably benign Het
Kif1a T C 1: 93,018,997 (GRCm38) H1763R probably damaging Het
Krt2 C T 15: 101,813,253 (GRCm38) R451H probably damaging Het
Lama2 A G 10: 26,990,867 (GRCm38) V2877A probably damaging Het
Lrrc2 A T 9: 110,962,617 (GRCm38) M80L probably benign Het
Naip6 A G 13: 100,302,260 (GRCm38) V343A probably benign Het
Nedd4l T C 18: 65,208,461 (GRCm38) Y753H probably damaging Het
Nif3l1 A C 1: 58,447,828 (GRCm38) S58R probably damaging Het
Olfr573-ps1 A T 7: 102,942,051 (GRCm38) C175* probably null Het
Or5w20 T A 2: 87,896,493 (GRCm38) V98E possibly damaging Het
Or9r3 G A 10: 130,112,580 (GRCm38) S70F probably damaging Het
Osbpl11 C A 16: 33,234,444 (GRCm38) Y632* probably null Het
Pask A T 1: 93,320,917 (GRCm38) D920E probably benign Het
Pclo T C 5: 14,681,594 (GRCm38) V3370A unknown Het
Ptpn21 G A 12: 98,704,240 (GRCm38) probably benign Het
Rph3al T C 11: 75,908,969 (GRCm38) I55V probably benign Het
Rsad2 T G 12: 26,454,168 (GRCm38) I121L possibly damaging Het
Sergef T G 7: 46,633,746 (GRCm38) probably benign Het
Sp110 C T 1: 85,589,120 (GRCm38) E219K possibly damaging Het
Tas2r104 T C 6: 131,685,471 (GRCm38) I92V probably benign Het
Tasor2 A G 13: 3,588,364 (GRCm38) S456P possibly damaging Het
Tbc1d23 T A 16: 57,173,106 (GRCm38) I566F possibly damaging Het
Tbc1d9b A G 11: 50,168,228 (GRCm38) probably null Het
Tie1 T A 4: 118,476,147 (GRCm38) I841L possibly damaging Het
Tpo A G 12: 30,100,486 (GRCm38) V465A probably benign Het
Ttll3 A T 6: 113,409,339 (GRCm38) Q711L probably damaging Het
Ttn C T 2: 76,953,041 (GRCm38) R869H probably benign Het
Uggt2 A G 14: 119,095,336 (GRCm38) V62A probably damaging Het
Usp34 T C 11: 23,384,509 (GRCm38) probably benign Het
Vmn1r17 C A 6: 57,361,319 (GRCm38) M20I probably benign Het
Vmn1r71 G C 7: 10,748,092 (GRCm38) S223C possibly damaging Het
Vmn2r120 C T 17: 57,524,518 (GRCm38) V424I probably benign Het
Vps13b T C 15: 35,417,633 (GRCm38) probably null Het
Wdfy3 C A 5: 101,957,443 (GRCm38) A173S probably benign Het
Wdr59 T C 8: 111,486,997 (GRCm38) probably null Het
Ythdc2 A T 18: 44,864,357 (GRCm38) M994L probably benign Het
Zfp808 T A 13: 62,172,306 (GRCm38) F450I probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,832,306 (GRCm38) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,790,068 (GRCm38) splice site probably benign
IGL00790:Dock4 APN 12 40,834,391 (GRCm38) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,702,969 (GRCm38) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,788,381 (GRCm38) splice site probably benign
IGL01412:Dock4 APN 12 40,730,041 (GRCm38) splice site probably benign
IGL01583:Dock4 APN 12 40,810,467 (GRCm38) nonsense probably null
IGL01603:Dock4 APN 12 40,693,031 (GRCm38) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,446,379 (GRCm38) nonsense probably null
IGL02067:Dock4 APN 12 40,834,385 (GRCm38) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,725,777 (GRCm38) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,777,207 (GRCm38) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,737,479 (GRCm38) missense probably benign
IGL02613:Dock4 APN 12 40,810,466 (GRCm38) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,668,430 (GRCm38) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,710,903 (GRCm38) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,779,160 (GRCm38) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,748,001 (GRCm38) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,692,907 (GRCm38) splice site probably benign
IGL03223:Dock4 APN 12 40,817,594 (GRCm38) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,733,257 (GRCm38) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,733,310 (GRCm38) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,817,758 (GRCm38) splice site probably null
BB005:Dock4 UTSW 12 40,788,303 (GRCm38) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,788,303 (GRCm38) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,737,360 (GRCm38) splice site probably benign
R0046:Dock4 UTSW 12 40,737,360 (GRCm38) splice site probably benign
R0110:Dock4 UTSW 12 40,621,312 (GRCm38) splice site probably benign
R0238:Dock4 UTSW 12 40,737,540 (GRCm38) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,737,540 (GRCm38) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,737,540 (GRCm38) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,737,540 (GRCm38) missense probably damaging 0.98
R0616:Dock4 UTSW 12 40,704,415 (GRCm38) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,710,884 (GRCm38) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,702,923 (GRCm38) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,704,481 (GRCm38) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,631,627 (GRCm38) splice site probably benign
R1087:Dock4 UTSW 12 40,729,938 (GRCm38) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,640,414 (GRCm38) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,829,616 (GRCm38) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,816,325 (GRCm38) frame shift probably null
R1468:Dock4 UTSW 12 40,755,810 (GRCm38) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,755,810 (GRCm38) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,693,025 (GRCm38) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,669,045 (GRCm38) missense probably damaging 0.99
R1682:Dock4 UTSW 12 40,725,780 (GRCm38) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,725,755 (GRCm38) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,834,722 (GRCm38) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,807,001 (GRCm38) splice site probably null
R1802:Dock4 UTSW 12 40,794,598 (GRCm38) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,636,228 (GRCm38) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,733,268 (GRCm38) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,710,798 (GRCm38) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,779,642 (GRCm38) splice site probably benign
R1986:Dock4 UTSW 12 40,730,063 (GRCm38) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,692,989 (GRCm38) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,745,668 (GRCm38) missense probably benign
R2135:Dock4 UTSW 12 40,745,668 (GRCm38) missense probably benign
R2154:Dock4 UTSW 12 40,844,548 (GRCm38) small insertion probably benign
R2154:Dock4 UTSW 12 40,820,662 (GRCm38) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,730,073 (GRCm38) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,623,801 (GRCm38) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,731,863 (GRCm38) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,672,810 (GRCm38) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,779,124 (GRCm38) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,794,624 (GRCm38) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,794,624 (GRCm38) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,844,267 (GRCm38) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,631,526 (GRCm38) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,446,365 (GRCm38) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,668,437 (GRCm38) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,817,746 (GRCm38) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,844,441 (GRCm38) missense probably benign
R5146:Dock4 UTSW 12 40,649,492 (GRCm38) splice site probably null
R5213:Dock4 UTSW 12 40,676,742 (GRCm38) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,704,466 (GRCm38) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,733,271 (GRCm38) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,745,745 (GRCm38) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,745,731 (GRCm38) missense probably benign
R5544:Dock4 UTSW 12 40,834,702 (GRCm38) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,649,480 (GRCm38) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,844,540 (GRCm38) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,737,491 (GRCm38) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,817,736 (GRCm38) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,621,251 (GRCm38) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,755,813 (GRCm38) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,755,834 (GRCm38) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,817,757 (GRCm38) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,748,110 (GRCm38) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,733,351 (GRCm38) splice site probably null
R6038:Dock4 UTSW 12 40,733,351 (GRCm38) splice site probably null
R6179:Dock4 UTSW 12 40,731,869 (GRCm38) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,828,955 (GRCm38) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,731,899 (GRCm38) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,704,466 (GRCm38) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,820,617 (GRCm38) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,812,326 (GRCm38) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,745,746 (GRCm38) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,812,326 (GRCm38) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,779,136 (GRCm38) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,834,635 (GRCm38) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,733,314 (GRCm38) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,621,286 (GRCm38) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,828,879 (GRCm38) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,636,159 (GRCm38) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,794,860 (GRCm38) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,788,244 (GRCm38) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,725,649 (GRCm38) nonsense probably null
R7720:Dock4 UTSW 12 40,806,975 (GRCm38) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,710,879 (GRCm38) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,710,879 (GRCm38) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,817,736 (GRCm38) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,725,677 (GRCm38) missense probably benign
R7879:Dock4 UTSW 12 40,730,084 (GRCm38) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,788,303 (GRCm38) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,833,119 (GRCm38) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,745,760 (GRCm38) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,702,951 (GRCm38) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,834,838 (GRCm38) splice site probably null
R8758:Dock4 UTSW 12 40,788,232 (GRCm38) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,745,731 (GRCm38) missense probably benign
R8873:Dock4 UTSW 12 40,676,768 (GRCm38) nonsense probably null
R8884:Dock4 UTSW 12 40,806,885 (GRCm38) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,704,338 (GRCm38) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,829,670 (GRCm38) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,649,405 (GRCm38) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,636,156 (GRCm38) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,844,394 (GRCm38) small insertion probably benign
R9675:Dock4 UTSW 12 40,844,380 (GRCm38) small insertion probably benign
R9676:Dock4 UTSW 12 40,844,398 (GRCm38) small insertion probably benign
R9676:Dock4 UTSW 12 40,844,388 (GRCm38) small insertion probably benign
R9676:Dock4 UTSW 12 40,844,380 (GRCm38) small insertion probably benign
R9676:Dock4 UTSW 12 40,844,402 (GRCm38) small insertion probably benign
R9678:Dock4 UTSW 12 40,844,397 (GRCm38) small insertion probably benign
R9678:Dock4 UTSW 12 40,844,388 (GRCm38) small insertion probably benign
R9678:Dock4 UTSW 12 40,844,380 (GRCm38) small insertion probably benign
R9691:Dock4 UTSW 12 40,636,098 (GRCm38) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,844,399 (GRCm38) frame shift probably null
RF025:Dock4 UTSW 12 40,844,393 (GRCm38) frame shift probably null
RF063:Dock4 UTSW 12 40,844,399 (GRCm38) frame shift probably null
X0028:Dock4 UTSW 12 40,669,047 (GRCm38) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,631,616 (GRCm38) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,631,614 (GRCm38) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,817,641 (GRCm38) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCTACTCCCTGGCATAGAGATTTGC -3'
(R):5'- TCCGAGGGGCTTATTAGAAGGGAC -3'

Sequencing Primer
(F):5'- ATGTCAGCTCTGTTAGGTAACC -3'
(R):5'- TGTCTGACTGTATGGCAGAAGAAC -3'
Posted On 2013-06-11