Incidental Mutation 'R0472:Fcho2'
ID46845
Institutional Source Beutler Lab
Gene Symbol Fcho2
Ensembl Gene ENSMUSG00000041685
Gene NameFCH domain only 2
Synonyms
MMRRC Submission 038672-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0472 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location98723403-98815449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98748267 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 431 (F431L)
Ref Sequence ENSEMBL: ENSMUSP00000042959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040340] [ENSMUST00000099277] [ENSMUST00000179563] [ENSMUST00000224992]
Predicted Effect probably benign
Transcript: ENSMUST00000040340
AA Change: F431L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000042959
Gene: ENSMUSG00000041685
AA Change: F431L

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
low complexity region 503 520 N/A INTRINSIC
Pfam:muHD 542 808 2.5e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099277
SMART Domains Protein: ENSMUSP00000096883
Gene: ENSMUSG00000041685

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 342 352 N/A INTRINSIC
low complexity region 434 457 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 504 521 N/A INTRINSIC
Pfam:muHD 543 803 4.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179563
SMART Domains Protein: ENSMUSP00000137422
Gene: ENSMUSG00000041685

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223634
Predicted Effect probably benign
Transcript: ENSMUST00000224992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225945
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,222,122 noncoding transcript Het
AI182371 T C 2: 35,085,206 N337S probably benign Het
Aldh3b1 C T 19: 3,914,024 R426H probably damaging Het
Arap2 A G 5: 62,706,659 F541L probably damaging Het
Asap2 G T 12: 21,213,185 R267L possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Bmp8b T A 4: 123,121,899 D226E probably benign Het
C1ra T A 6: 124,517,444 D283E possibly damaging Het
Cacul1 G T 19: 60,543,026 H268Q probably damaging Het
Cd9 T C 6: 125,472,433 N49D probably benign Het
Cdc42bpa A G 1: 180,040,179 H193R probably damaging Het
Cep290 G A 10: 100,551,455 G1935E probably benign Het
Cep350 A T 1: 155,914,723 I1362N probably damaging Het
Chchd7 A T 4: 3,943,416 N61I possibly damaging Het
Clca1 A T 3: 145,027,345 L134Q probably damaging Het
Clec2j T C 6: 128,656,602 noncoding transcript Het
Clvs1 G A 4: 9,281,801 A82T probably damaging Het
Csn1s1 A T 5: 87,677,627 Y231F possibly damaging Het
Cyp2c55 A T 19: 39,031,379 T254S probably benign Het
D430042O09Rik A G 7: 125,872,967 N1548S probably damaging Het
Decr1 A G 4: 15,919,849 S290P probably damaging Het
Dnaic2 T A 11: 114,745,189 probably benign Het
Dock4 C A 12: 40,838,438 probably benign Het
Dst T C 1: 34,266,960 probably null Het
Elmo2 A G 2: 165,298,330 I315T probably damaging Het
Fam208b A G 13: 3,588,364 S456P possibly damaging Het
Fez2 A G 17: 78,384,832 probably benign Het
Gas2l3 C T 10: 89,426,477 A128T probably damaging Het
Hpse2 T C 19: 43,013,163 I222M probably damaging Het
Kcna2 A G 3: 107,105,516 D471G probably benign Het
Kcnj13 T A 1: 87,386,846 Y218F probably benign Het
Kif1a T C 1: 93,018,997 H1763R probably damaging Het
Krt2 C T 15: 101,813,253 R451H probably damaging Het
Lama2 A G 10: 26,990,867 V2877A probably damaging Het
Lrrc2 A T 9: 110,962,617 M80L probably benign Het
Naip6 A G 13: 100,302,260 V343A probably benign Het
Nedd4l T C 18: 65,208,461 Y753H probably damaging Het
Nif3l1 A C 1: 58,447,828 S58R probably damaging Het
Olfr1153 T A 2: 87,896,493 V98E possibly damaging Het
Olfr573-ps1 A T 7: 102,942,051 C175* probably null Het
Olfr823 G A 10: 130,112,580 S70F probably damaging Het
Osbpl11 C A 16: 33,234,444 Y632* probably null Het
Pask A T 1: 93,320,917 D920E probably benign Het
Pclo T C 5: 14,681,594 V3370A unknown Het
Ptpn21 G A 12: 98,704,240 probably benign Het
Rph3al T C 11: 75,908,969 I55V probably benign Het
Rsad2 T G 12: 26,454,168 I121L possibly damaging Het
Sergef T G 7: 46,633,746 probably benign Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Tas2r104 T C 6: 131,685,471 I92V probably benign Het
Tbc1d23 T A 16: 57,173,106 I566F possibly damaging Het
Tbc1d9b A G 11: 50,168,228 probably null Het
Tie1 T A 4: 118,476,147 I841L possibly damaging Het
Tpo A G 12: 30,100,486 V465A probably benign Het
Ttll3 A T 6: 113,409,339 Q711L probably damaging Het
Ttn C T 2: 76,953,041 R869H probably benign Het
Uggt2 A G 14: 119,095,336 V62A probably damaging Het
Usp34 T C 11: 23,384,509 probably benign Het
Vmn1r17 C A 6: 57,361,319 M20I probably benign Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r120 C T 17: 57,524,518 V424I probably benign Het
Vps13b T C 15: 35,417,633 probably null Het
Wdfy3 C A 5: 101,957,443 A173S probably benign Het
Wdr59 T C 8: 111,486,997 probably null Het
Ythdc2 A T 18: 44,864,357 M994L probably benign Het
Zfp808 T A 13: 62,172,306 F450I probably damaging Het
Other mutations in Fcho2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fcho2 APN 13 98789807 missense probably benign
IGL02058:Fcho2 APN 13 98730906 missense probably damaging 0.98
IGL02516:Fcho2 APN 13 98730212 missense probably benign 0.08
IGL02715:Fcho2 APN 13 98796335 missense probably damaging 1.00
IGL03243:Fcho2 APN 13 98777384 splice site probably benign
R0044:Fcho2 UTSW 13 98755544 intron probably benign
R0087:Fcho2 UTSW 13 98735086 missense probably benign 0.00
R0501:Fcho2 UTSW 13 98764515 missense possibly damaging 0.92
R1022:Fcho2 UTSW 13 98732659 missense probably damaging 1.00
R1024:Fcho2 UTSW 13 98732659 missense probably damaging 1.00
R1130:Fcho2 UTSW 13 98748289 missense probably damaging 1.00
R1495:Fcho2 UTSW 13 98749850 critical splice donor site probably null
R1593:Fcho2 UTSW 13 98784807 missense possibly damaging 0.92
R1608:Fcho2 UTSW 13 98726198 missense probably benign 0.01
R1638:Fcho2 UTSW 13 98745895 missense possibly damaging 0.83
R1643:Fcho2 UTSW 13 98784816 missense probably benign 0.00
R2125:Fcho2 UTSW 13 98775898 missense possibly damaging 0.83
R3117:Fcho2 UTSW 13 98777438 missense probably damaging 1.00
R3968:Fcho2 UTSW 13 98735056 missense probably benign 0.06
R3970:Fcho2 UTSW 13 98735056 missense probably benign 0.06
R4079:Fcho2 UTSW 13 98755612 missense probably damaging 0.99
R4816:Fcho2 UTSW 13 98806366 missense probably damaging 1.00
R5338:Fcho2 UTSW 13 98730891 missense probably damaging 1.00
R5437:Fcho2 UTSW 13 98777474 missense possibly damaging 0.95
R5457:Fcho2 UTSW 13 98789767 missense probably damaging 0.99
R5733:Fcho2 UTSW 13 98789802 missense probably damaging 0.99
R6136:Fcho2 UTSW 13 98789767 missense probably damaging 0.99
R6186:Fcho2 UTSW 13 98815083 missense probably benign 0.01
R6365:Fcho2 UTSW 13 98789859 missense probably benign 0.20
R7041:Fcho2 UTSW 13 98784826 missense possibly damaging 0.72
R7168:Fcho2 UTSW 13 98789463 missense probably benign
R7218:Fcho2 UTSW 13 98753613 intron probably null
R7243:Fcho2 UTSW 13 98755216 missense possibly damaging 0.94
R7533:Fcho2 UTSW 13 98784799 missense probably benign 0.00
X0018:Fcho2 UTSW 13 98732082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCTGACAGAAGAGAGATGGTTC -3'
(R):5'- GTCTATCAGGTAGCTCATCCACATTGC -3'

Sequencing Primer
(F):5'- GATGGAACTCACTATTACTGGATGAC -3'
(R):5'- CCCTGCCAACAAGATGTTATATTG -3'
Posted On2013-06-11