Incidental Mutation 'R0472:Nedd4l'
ID 46854
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 038672-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R0472 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65341532 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 753 (Y753H)
Ref Sequence ENSEMBL: ENSMUSP00000153526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080418
AA Change: Y753H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: Y753H

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: Y874H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: Y874H

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224347
AA Change: Y733H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably damaging
Transcript: ENSMUST00000226058
AA Change: Y753H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8932 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,222,123 (GRCm39) noncoding transcript Het
AI182371 T C 2: 34,975,218 (GRCm39) N337S probably benign Het
Aldh3b1 C T 19: 3,964,024 (GRCm39) R426H probably damaging Het
Arap2 A G 5: 62,864,002 (GRCm39) F541L probably damaging Het
Asap2 G T 12: 21,263,186 (GRCm39) R267L possibly damaging Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Bmp8b T A 4: 123,015,692 (GRCm39) D226E probably benign Het
C1ra T A 6: 124,494,403 (GRCm39) D283E possibly damaging Het
Cacul1 G T 19: 60,531,464 (GRCm39) H268Q probably damaging Het
Cd9 T C 6: 125,449,396 (GRCm39) N49D probably benign Het
Cdc42bpa A G 1: 179,867,744 (GRCm39) H193R probably damaging Het
Cep290 G A 10: 100,387,317 (GRCm39) G1935E probably benign Het
Cep350 A T 1: 155,790,469 (GRCm39) I1362N probably damaging Het
Chchd7 A T 4: 3,943,416 (GRCm39) N61I possibly damaging Het
Clca3a1 A T 3: 144,733,106 (GRCm39) L134Q probably damaging Het
Clec2j T C 6: 128,633,565 (GRCm39) noncoding transcript Het
Clvs1 G A 4: 9,281,801 (GRCm39) A82T probably damaging Het
Csn1s1 A T 5: 87,825,486 (GRCm39) Y231F possibly damaging Het
Cyp2c55 A T 19: 39,019,823 (GRCm39) T254S probably benign Het
Decr1 A G 4: 15,919,849 (GRCm39) S290P probably damaging Het
Dnai2 T A 11: 114,636,015 (GRCm39) probably benign Het
Dock4 C A 12: 40,888,437 (GRCm39) probably benign Het
Dst T C 1: 34,306,041 (GRCm39) probably null Het
Elmo2 A G 2: 165,140,250 (GRCm39) I315T probably damaging Het
Fcho2 A G 13: 98,884,775 (GRCm39) F431L probably benign Het
Fez2 A G 17: 78,692,261 (GRCm39) probably benign Het
Gas2l3 C T 10: 89,262,339 (GRCm39) A128T probably damaging Het
Hpse2 T C 19: 43,001,602 (GRCm39) I222M probably damaging Het
Katnip A G 7: 125,472,139 (GRCm39) N1548S probably damaging Het
Kcna2 A G 3: 107,012,832 (GRCm39) D471G probably benign Het
Kcnj13 T A 1: 87,314,568 (GRCm39) Y218F probably benign Het
Kif1a T C 1: 92,946,719 (GRCm39) H1763R probably damaging Het
Krt1c C T 15: 101,721,688 (GRCm39) R451H probably damaging Het
Lama2 A G 10: 26,866,863 (GRCm39) V2877A probably damaging Het
Lrrc2 A T 9: 110,791,685 (GRCm39) M80L probably benign Het
Naip6 A G 13: 100,438,768 (GRCm39) V343A probably benign Het
Nif3l1 A C 1: 58,486,987 (GRCm39) S58R probably damaging Het
Or51h7 A T 7: 102,591,258 (GRCm39) C175* probably null Het
Or5w20 T A 2: 87,726,837 (GRCm39) V98E possibly damaging Het
Or9r3 G A 10: 129,948,449 (GRCm39) S70F probably damaging Het
Osbpl11 C A 16: 33,054,814 (GRCm39) Y632* probably null Het
Pask A T 1: 93,248,639 (GRCm39) D920E probably benign Het
Pclo T C 5: 14,731,608 (GRCm39) V3370A unknown Het
Ptpn21 G A 12: 98,670,499 (GRCm39) probably benign Het
Rph3al T C 11: 75,799,795 (GRCm39) I55V probably benign Het
Rsad2 T G 12: 26,504,167 (GRCm39) I121L possibly damaging Het
Sergef T G 7: 46,283,170 (GRCm39) probably benign Het
Sp110 C T 1: 85,516,841 (GRCm39) E219K possibly damaging Het
Tas2r104 T C 6: 131,662,434 (GRCm39) I92V probably benign Het
Tasor2 A G 13: 3,638,364 (GRCm39) S456P possibly damaging Het
Tbc1d23 T A 16: 56,993,469 (GRCm39) I566F possibly damaging Het
Tbc1d9b A G 11: 50,059,055 (GRCm39) probably null Het
Tie1 T A 4: 118,333,344 (GRCm39) I841L possibly damaging Het
Tpo A G 12: 30,150,485 (GRCm39) V465A probably benign Het
Ttll3 A T 6: 113,386,300 (GRCm39) Q711L probably damaging Het
Ttn C T 2: 76,783,385 (GRCm39) R869H probably benign Het
Uggt2 A G 14: 119,332,748 (GRCm39) V62A probably damaging Het
Usp34 T C 11: 23,334,509 (GRCm39) probably benign Het
Vmn1r17 C A 6: 57,338,304 (GRCm39) M20I probably benign Het
Vmn1r71 G C 7: 10,482,019 (GRCm39) S223C possibly damaging Het
Vmn2r120 C T 17: 57,831,518 (GRCm39) V424I probably benign Het
Vps13b T C 15: 35,417,779 (GRCm39) probably null Het
Wdfy3 C A 5: 102,105,309 (GRCm39) A173S probably benign Het
Wdr59 T C 8: 112,213,629 (GRCm39) probably null Het
Ythdc2 A T 18: 44,997,424 (GRCm39) M994L probably benign Het
Zfp808 T A 13: 62,320,120 (GRCm39) F450I probably damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGAGTAGACTTGTTGACTGTGAC -3'
(R):5'- TTTTCTGAGCCCAACAGACTAGAAACC -3'

Sequencing Primer
(F):5'- ACTGTGACAGTCAGTTGTGC -3'
(R):5'- TCACACAGAGCTCAGGACTTC -3'
Posted On 2013-06-11